{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Pharyngula\" and tissue_curation = \"Heart\"", "rows": [[36641, "SRR700539", "SRX233125", "SRS393099", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq15", "GSM1081113", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "Seq15", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "GSM1081113", "GSM1081113: Seq15; Danio rerio; RNA Seq", "GSM1081113 1", null, "1", null, "GEO Accession:GSM1081113", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP018538", null, null, null, null, 1505008521.0, 29509971.0, "GSM1081113 r1", "0:51", "A:394410844;C:370013758;G:356489603;T:384055071;N:39245", 51, null, null, null, 394410844, 370013758, 356489603, 384055071, 39245, "SRX233125", "SRS393099", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.9123, null, 0.07373, null, 0.71346, null, 0.47555, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36642, "SRR700538", "SRX233124", "SRS393098", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq14", "GSM1081112", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "Seq14", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "GSM1081112", "GSM1081112: Seq14; Danio rerio; RNA Seq", "GSM1081112 1", null, "1", null, "GEO Accession:GSM1081112", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP018538", null, null, "seq14.txt.gz", "fastq", 3144425502.0, 61655402.0, "GSM1081112 r1", "0:51", "A:825172912;C:756354008;G:742919584;T:819897573;N:81425", 51, null, null, null, 825172912, 756354008, 742919584, 819897573, 81425, "SRX233124", "SRS393098", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.93659, null, 0.0806, null, 0.73716, null, 0.47614, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36643, "SRR700537", "SRX233123", "SRS393097", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq11", "GSM1081111", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "Seq11", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "GSM1081111", "GSM1081111: Seq11; Danio rerio; RNA Seq", "GSM1081111 1", null, "1", null, "GEO Accession:GSM1081111", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP018538", null, null, null, null, 1364181264.0, 37893924.0, "GSM1081111 r1", "0:36", "A:362442341;C:297159061;G:406723961;T:297355968;N:499933", 36, null, null, null, 362442341, 297159061, 406723961, 297355968, 499933, "SRX233123", "SRS393097", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.67174, null, 0.07612, null, 0.74416, null, 0.48016, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36644, "SRR700536", "SRX233122", "SRS393096", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq13", "GSM1081110", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "Seq13", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "GSM1081110", "GSM1081110: Seq13; Danio rerio; RNA Seq", "GSM1081110 1", null, "1", null, "GEO Accession:GSM1081110", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP018538", null, null, "seq13.txt.gz", "fastq", 1693675269.0, 33209319.0, "GSM1081110 r1", "0:51", "A:443719209;C:411369010;G:404182982;T:434361031;N:43037", 51, null, null, null, 443719209, 411369010, 404182982, 434361031, 43037, "SRX233122", "SRS393096", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.91781, null, 0.08107, null, 0.74976, null, 0.46528, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36645, "SRR700535", "SRX233121", "SRS393095", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq5", "GSM1081109", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "Seq5", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "GSM1081109", "GSM1081109: Seq5; Danio rerio; RNA Seq", "GSM1081109 1", null, "1", null, "GEO Accession:GSM1081109", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP018538", null, null, "seq5.txt.gz", "fastq", 1245644280.0, 34601230.0, "GSM1081109 r1", "0:36", "A:334131135;C:287707996;G:288492153;T:334895459;N:417537", 36, null, null, null, 334131135, 287707996, 288492153, 334895459, 417537, "SRX233121", "SRS393095", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.89495, null, 0.1058, null, 0.74247, null, 0.46422, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36646, "SRR700534", "SRX233120", "SRS393094", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq1", "GSM1081108", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "Seq1", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "GSM1081108", "GSM1081108: Seq1; Danio rerio; RNA Seq", "GSM1081108 1", null, "1", null, "GEO Accession:GSM1081108", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP018538", null, null, "seq1.txt.gz", "fastq", 929284704.0, 25813464.0, "GSM1081108 r1", "0:36", "A:244730361;C:220466820;G:213037296;T:250386569;N:663658", 36, null, null, null, 244730361, 220466820, 213037296, 250386569, 663658, "SRX233120", "SRS393094", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.87436, null, 0.11629, null, 0.73302, null, 0.46999, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [41532, "SRR5006039", "SRX2337867", "SRS1791085", "SRP092952", "PRJNA352869", "The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome", "GSE89670", "Other", "Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types  as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies  we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed \"biotagging\"  a versatile methodology that uses genetically encoded components to biotinylate target proteins  enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our \"biotagging\" toolkit  we demonstrate the specificity of our approach at the biochemical  cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus  we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity  embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that \"biotagging\" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.", null, "pubmed:28402863", null, "Myl7 RNASeq Nuclear 26hpf 2", "GSM2386502", null, "source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse", "Myl7 RNASeq Nuclear 26hpf 2", "ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files", "Myl7 RNASeq Nuclear 26hpf", null, "Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext\u00ae PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.", null, "strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse", "GSM2386502", "GSM2386502: Myl7 RNASeq Nuclear 26hpf 2; Danio rerio; RNA Seq", "GSM2386502", null, "1", "Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext\u00ae PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.", "GEO Accession:GSM2386502", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP092952", null, null, "Myl7_RNASeq_Nuclear_26hpf_2_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_2_R2.fastq.gz", "fastq fastq", 5163276312.0, 50620356.0, "GSM2386502 r1", "0:51 1:51", "A:1144341926;C:1402381884;G:1460666304;T:1155627236;N:258962", 51, 51, null, null, 1144341926, 1402381884, 1460666304, 1155627236, 258962, "SRX2337867", "SRS1791085", "SRA491940", "GEO", "Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine", 2, 0.79148, 0.79923, 0.1676, 0.16851, 0.74501, 0.74395, 0.44104, 0.45239, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-11-08", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [41533, "SRR5006038", "SRX2337866", "SRS1791086", "SRP092952", "PRJNA352869", "The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome", "GSE89670", "Other", "Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types  as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies  we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed \"biotagging\"  a versatile methodology that uses genetically encoded components to biotinylate target proteins  enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our \"biotagging\" toolkit  we demonstrate the specificity of our approach at the biochemical  cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus  we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity  embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that \"biotagging\" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.", null, "pubmed:28402863", null, "Myl7 RNASeq Nuclear 26hpf 1", "GSM2386501", null, "source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse", "Myl7 RNASeq Nuclear 26hpf 1", "ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files", "Myl7 RNASeq Nuclear 26hpf", null, "Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext\u00ae PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.", null, "strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse", "GSM2386501", "GSM2386501: Myl7 RNASeq Nuclear 26hpf 1; Danio rerio; RNA Seq", "GSM2386501", null, "1", "Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext\u00ae PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.", "GEO Accession:GSM2386501", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP092952", null, null, "Myl7_RNASeq_Nuclear_26hpf_1_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_1_R2.fastq.gz", "fastq fastq", 4985333334.0, 48875817.0, "GSM2386501 r1", "0:51 1:51", "A:1030896260;C:1411954598;G:1508330460;T:1033900255;N:251761", 51, 51, null, null, 1030896260, 1411954598, 1508330460, 1033900255, 251761, "SRX2337866", "SRS1791086", "SRA491940", "GEO", "Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine", 2, 0.7362, 0.7434, 0.12786, 0.12837, 0.75952, 0.76065, 0.47917, 0.48384, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-11-08", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43729, "SRR6039675", "SRX3187839", "SRS2515287", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "B30", null, "time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "B30", "B30", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X9_130405_SN141_0668_AD2154ACXX_8.txt.gz", "fastq", 1120008050.0, 22400161.0, "9499X9 130405 SN141 0668 AD2154ACXX 8.txt.gz", "0:50", "A:276093341;C:277073909;G:281519716;T:285221666;N:99418", 50, null, null, null, 276093341, 277073909, 281519716, 285221666, 99418, "SRX3187839", "SRS2515287", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.88679, null, 0.20435, null, 0.77185, null, 0.58996, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43730, "SRR6039676", "SRX3187838", "SRS2515286", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "B36", null, "time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "B36", "B36", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X10_130405_SN141_0668_AD2154ACXX_8.txt.gz", "fastq", 1568417300.0, 31368346.0, "9499X10 130405 SN141 0668 AD2154ACXX 8.txt.gz", "0:50", "A:387419891;C:388387212;G:394030807;T:398440283;N:139107", 50, null, null, null, 387419891, 388387212, 394030807, 398440283, 139107, "SRX3187838", "SRS2515286", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.89157, null, 0.18037, null, 0.76286, null, 0.63654, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43731, "SRR6039677", "SRX3187837", "SRS2515285", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "A30", null, "time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "A30", "A30", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X1_130405_SN141_0668_AD2154ACXX_7.txt.gz", "fastq", 1591462700.0, 31829254.0, "9499X1 130405 SN141 0668 AD2154ACXX 7.txt.gz", "0:50", "A:340306422;C:441595911;G:442592098;T:366852440;N:115829", 50, null, null, null, 340306422, 441595911, 442592098, 366852440, 115829, "SRX3187837", "SRS2515285", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.4932, null, 0.13089, null, 0.90962, null, 0.7432, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43732, "SRR6039678", "SRX3187836", "SRS2515284", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "A36", null, "time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "A36", "A36", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X2_130405_SN141_0668_AD2154ACXX_7.txt.gz", "fastq", 1328412500.0, 26568250.0, "9499X2 130405 SN141 0668 AD2154ACXX 7.txt.gz", "0:50", "A:307478316;C:349102549;G:350562927;T:321170451;N:98257", 50, null, null, null, 307478316, 349102549, 350562927, 321170451, 98257, "SRX3187836", "SRS2515284", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.51716, null, 0.15839, null, 0.86642, null, 0.61201, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43733, "SRR6039679", "SRX3187835", "SRS2515283", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "A42", null, "time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "A42", "A42", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X3_130405_SN141_0668_AD2154ACXX_7.txt.gz", "fastq", 1101079300.0, 22021586.0, "9499X3 130405 SN141 0668 AD2154ACXX 7.txt.gz", "0:50", "A:258171407;C:286688991;G:285879983;T:270258877;N:80042", 50, null, null, null, 258171407, 286688991, 285879983, 270258877, 80042, "SRX3187835", "SRS2515283", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.35588, null, 0.10785, null, 0.88116, null, 0.69861, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43739, "SRR6039685", "SRX3187829", "SRS2515277", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "C42", null, "time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "C42", "C42", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X19_130410_SN141_0670_AD228RACXX_8.txt.gz", "fastq", 1404005750.0, 28080115.0, "9499X19 130410 SN141 0670 AD228RACXX 8.txt.gz", "0:50", "A:363329939;C:325066287;G:334263296;T:381124430;N:221798", 50, null, null, null, 363329939, 325066287, 334263296, 381124430, 221798, "SRX3187829", "SRS2515277", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.84646, null, 0.20569, null, 0.75856, null, 0.66427, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43743, "SRR6039689", "SRX3187825", "SRS2515273", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "C30", null, "time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "C30", "C30", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X17_130410_SN141_0670_AD228RACXX_7.txt.gz", "fastq", 1261245200.0, 25224904.0, "9499X17 130410 SN141 0670 AD228RACXX 7.txt.gz", "0:50", "A:319419875;C:303300361;G:307895242;T:330428818;N:200904", 50, null, null, null, 319419875, 303300361, 307895242, 330428818, 200904, "SRX3187825", "SRS2515273", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.87549, null, 0.23233, null, 0.77325, null, 0.65489, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43744, "SRR6039690", "SRX3187824", "SRS2515272", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "C36", null, "time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "C36", "C36", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X18_130410_SN141_0670_AD228RACXX_7.txt.gz", "fastq", 1263613900.0, 25272278.0, "9499X18 130410 SN141 0670 AD228RACXX 7.txt.gz", "0:50", "A:310002055;C:309104393;G:317720866;T:326586067;N:200519", 50, null, null, null, 310002055, 309104393, 317720866, 326586067, 200519, "SRX3187824", "SRS2515272", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.84147, null, 0.2007, null, 0.78839, null, 0.61872, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [43745, "SRR6039691", "SRX3187823", "SRS2515271", "SRP117696", "PRJNA407368", "RNA seq timecourse analysis during zebrafish heart looping morphogenesis", "PRJNA407368", "Other", "During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.", null, null, null, null, "B42", null, "time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf", "B42", "B42", "For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP117696", null, null, "9499X11_130405_SN141_0668_AD2154ACXX_8.txt.gz", "fastq", 1714029850.0, 34280597.0, "9499X11 130405 SN141 0668 AD2154ACXX 8.txt.gz", "0:50", "A:341571294;C:484054132;G:501201310;T:387056138;N:146976", 50, null, null, null, 341571294, 484054132, 501201310, 387056138, 146976, "SRX3187823", "SRS2515271", "SRA608458", "University of Utah|Neurobiology and Anatomy", "University of Utah", 1, 0.72224, null, 0.18688, null, 0.92151, null, 0.71808, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-09-14", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48231, "SRR7119834", "SRX4041477", "SRS3259001", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 9", "GSM3131225", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 9", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131225", "GSM3131225: Danio rerio RNAseq singleHeart 1dpf mut 9; Danio rerio; RNA Seq", "GSM3131225", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131225", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_9_NDCII_sample_0023.fastq.gz", "fastq", 57070136.0, 762325.0, "GSM3131225 r1", "0:74.86", "A:18605697;C:9652744;G:12793849;T:15973861;N:43985", 74, null, null, null, 18605697, 9652744, 12793849, 15973861, 43985, "SRX4041477", "SRS3259001", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.65648, null, 0.53947, null, 0.94448, null, 0.46511, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48232, "SRR7119833", "SRX4041476", "SRS3258954", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 7", "GSM3131224", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 7", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131224", "GSM3131224: Danio rerio RNAseq singleHeart 1dpf mut 7; Danio rerio; RNA Seq", "GSM3131224", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131224", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_7_NDCII_sample_0020.fastq.gz", "fastq", 95756013.0, 1278688.0, "GSM3131224 r1", "0:74.89", "A:31571219;C:16875591;G:19112888;T:28125288;N:71027", 74, null, null, null, 31571219, 16875591, 19112888, 28125288, 71027, "SRX4041476", "SRS3258954", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.77787, null, 0.38573, null, 0.89491, null, 0.52033, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48233, "SRR7119832", "SRX4041475", "SRS3258953", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 6", "GSM3131223", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 6", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131223", "GSM3131223: Danio rerio RNAseq singleHeart 1dpf mut 6; Danio rerio; RNA Seq", "GSM3131223", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131223", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_6_NDCII_sample_0019.fastq.gz", "fastq", 42326230.0, 565166.0, "GSM3131223 r1", "0:74.89", "A:13786789;C:7205959;G:8673068;T:12629903;N:30511", 74, null, null, null, 13786789, 7205959, 8673068, 12629903, 30511, "SRX4041475", "SRS3258953", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.81231, null, 0.24386, null, 0.91662, null, 0.54902, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48234, "SRR7119831", "SRX4041474", "SRS3258952", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 5", "GSM3131222", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 5", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131222", "GSM3131222: Danio rerio RNAseq singleHeart 1dpf mut 5; Danio rerio; RNA Seq", "GSM3131222", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131222", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_5_NDCII_sample_0018.fastq.gz", "fastq", 19727283.0, 263414.0, "GSM3131222 r1", "0:74.89", "A:6628087;C:3386996;G:3817542;T:5879595;N:15063", 74, null, null, null, 6628087, 3386996, 3817542, 5879595, 15063, "SRX4041474", "SRS3258952", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.77937, null, 0.38158, null, 0.93681, null, 0.49785, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48235, "SRR7119830", "SRX4041473", "SRS3258951", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 4", "GSM3131221", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 4", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131221", "GSM3131221: Danio rerio RNAseq singleHeart 1dpf mut 4; Danio rerio; RNA Seq", "GSM3131221", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131221", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_4_NDCII_sample_0017.fastq.gz", "fastq", 58279623.0, 778471.0, "GSM3131221 r1", "0:74.86", "A:18649049;C:9706373;G:12497900;T:17382327;N:43974", 74, null, null, null, 18649049, 9706373, 12497900, 17382327, 43974, "SRX4041473", "SRS3258951", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.7618, null, 0.36032, null, 0.91425, null, 0.50881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48236, "SRR7119829", "SRX4041472", "SRS3258950", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 3", "GSM3131220", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 3", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131220", "GSM3131220: Danio rerio RNAseq singleHeart 1dpf mut 3; Danio rerio; RNA Seq", "GSM3131220", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131220", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_3_NDCII_sample_0016.fastq.gz", "fastq", 76875810.0, 1027192.0, "GSM3131220 r1", "0:74.84", "A:25047740;C:13094049;G:17143346;T:21533451;N:57224", 74, null, null, null, 25047740, 13094049, 17143346, 21533451, 57224, "SRX4041472", "SRS3258950", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.73765, null, 0.57489, null, 0.91297, null, 0.50116, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48237, "SRR7119828", "SRX4041471", "SRS3258949", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 2", "GSM3131219", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 2", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131219", "GSM3131219: Danio rerio RNAseq singleHeart 1dpf mut 2; Danio rerio; RNA Seq", "GSM3131219", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131219", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_2_NDCII_sample_0015.fastq.gz", "fastq", 279841644.0, 3736395.0, "GSM3131219 r1", "0:74.90", "A:89952643;C:48371385;G:56655773;T:84653645;N:208198", 74, null, null, null, 89952643, 48371385, 56655773, 84653645, 208198, "SRX4041471", "SRS3258949", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.83707, null, 0.16537, null, 0.8449, null, 0.51435, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48238, "SRR7119827", "SRX4041470", "SRS3258948", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf mut 1", "GSM3131218", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "Danio rerio RNAseq singleHeart 1dpf mut 1", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / ", "GSM3131218", "GSM3131218: Danio rerio RNAseq singleHeart 1dpf mut 1; Danio rerio; RNA Seq", "GSM3131218", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131218", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "mut_1_1_NDCII_sample_0014.fastq.gz", "fastq", 11439626.0, 152750.0, "GSM3131218 r1", "0:74.89", "A:3900812;C:1903149;G:2137242;T:3490826;N:7597", 74, null, null, null, 3900812, 1903149, 2137242, 3490826, 7597, "SRX4041470", "SRS3258948", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.81522, null, 0.22036, null, 0.9427, null, 0.50565, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48239, "SRR7119826", "SRX4041469", "SRS3258947", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 11", "GSM3131217", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 11", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131217", "GSM3131217: Danio rerio RNAseq singleHeart 1dpf wt 11; Danio rerio; RNA Seq", "GSM3131217", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131217", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_11_NDCII_sample_0013.fastq.gz", "fastq", 42251524.0, 564309.0, "GSM3131217 r1", "0:74.87", "A:13857230;C:6932231;G:9360286;T:12071859;N:29918", 74, null, null, null, 13857230, 6932231, 9360286, 12071859, 29918, "SRX4041469", "SRS3258947", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.73137, null, 0.44634, null, 0.93196, null, 0.46969, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48240, "SRR7119825", "SRX4041468", "SRS3258946", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 9", "GSM3131216", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 9", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131216", "GSM3131216: Danio rerio RNAseq singleHeart 1dpf wt 9; Danio rerio; RNA Seq", "GSM3131216", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131216", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_9_NDCII_sample_0010.fastq.gz", "fastq", 140217783.0, 1872511.0, "GSM3131216 r1", "0:74.88", "A:48060012;C:23208078;G:28722039;T:40121038;N:106616", 74, null, null, null, 48060012, 23208078, 28722039, 40121038, 106616, "SRX4041468", "SRS3258946", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.80665, null, 0.32237, null, 0.86778, null, 0.52038, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48241, "SRR7119824", "SRX4041467", "SRS3258945", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 7", "GSM3131215", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 7", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131215", "GSM3131215: Danio rerio RNAseq singleHeart 1dpf wt 7; Danio rerio; RNA Seq", "GSM3131215", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131215", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_7_NDCII_sample_0008.fastq.gz", "fastq", 23549291.0, 314631.0, "GSM3131215 r1", "0:74.85", "A:8015580;C:3998401;G:4892477;T:6623855;N:18978", 74, null, null, null, 8015580, 3998401, 4892477, 6623855, 18978, "SRX4041467", "SRS3258945", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.71017, null, 0.48929, null, 0.94817, null, 0.56724, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48242, "SRR7119823", "SRX4041466", "SRS3258944", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 6", "GSM3131214", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 6", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131214", "GSM3131214: Danio rerio RNAseq singleHeart 1dpf wt 6; Danio rerio; RNA Seq", "GSM3131214", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131214", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_6_NDCII_sample_0007.fastq.gz", "fastq", 129689911.0, 1732243.0, "GSM3131214 r1", "0:74.87", "A:40869250;C:21297938;G:30638559;T:36786070;N:98094", 74, null, null, null, 40869250, 21297938, 30638559, 36786070, 98094, "SRX4041466", "SRS3258944", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.77101, null, 0.59088, null, 0.88824, null, 0.5086, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48243, "SRR7119822", "SRX4041465", "SRS3258943", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 5", "GSM3131213", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 5", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131213", "GSM3131213: Danio rerio RNAseq singleHeart 1dpf wt 5; Danio rerio; RNA Seq", "GSM3131213", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131213", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_5_NDCII_sample_0006.fastq.gz", "fastq", 24218974.0, 323441.0, "GSM3131213 r1", "0:74.88", "A:8220059;C:3989695;G:4906493;T:7085365;N:17362", 74, null, null, null, 8220059, 3989695, 4906493, 7085365, 17362, "SRX4041465", "SRS3258943", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.76586, null, 0.49207, null, 0.93501, null, 0.55288, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48244, "SRR7119821", "SRX4041464", "SRS3258942", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 4", "GSM3131212", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 4", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131212", "GSM3131212: Danio rerio RNAseq singleHeart 1dpf wt 4; Danio rerio; RNA Seq", "GSM3131212", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131212", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_4_NDCII_sample_0005.fastq.gz", "fastq", 22001311.0, 293804.0, "GSM3131212 r1", "0:74.88", "A:7350666;C:3795843;G:4584903;T:6252967;N:16932", 74, null, null, null, 7350666, 3795843, 4584903, 6252967, 16932, "SRX4041464", "SRS3258942", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.7875, null, 0.22891, null, 0.93835, null, 0.52263, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48245, "SRR7119820", "SRX4041463", "SRS3258941", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 3", "GSM3131211", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 3", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131211", "GSM3131211: Danio rerio RNAseq singleHeart 1dpf wt 3; Danio rerio; RNA Seq", "GSM3131211", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131211", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_3_NDCII_sample_0004.fastq.gz", "fastq", 113079916.0, 1510783.0, "GSM3131211 r1", "0:74.85", "A:37699535;C:19622685;G:23847263;T:31822581;N:87852", 74, null, null, null, 37699535, 19622685, 23847263, 31822581, 87852, "SRX4041463", "SRS3258941", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.76704, null, 0.49567, null, 0.89045, null, 0.51015, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48246, "SRR7119819", "SRX4041462", "SRS3258977", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 2", "GSM3131210", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 2", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131210", "GSM3131210: Danio rerio RNAseq singleHeart 1dpf wt 2; Danio rerio; RNA Seq", "GSM3131210", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131210", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_2_NDCII_sample_0003.fastq.gz", "fastq", 28758160.0, 384087.0, "GSM3131210 r1", "0:74.87", "A:9200574;C:4647591;G:6808365;T:8081607;N:20023", 74, null, null, null, 9200574, 4647591, 6808365, 8081607, 20023, "SRX4041462", "SRS3258977", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.749, null, 0.43154, null, 0.92498, null, 0.50112, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [48247, "SRR7119818", "SRX4041461", "SRS3258961", "SRP144601", "PRJNA459724", "The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis", "GSE114038", "Other", "Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively", null, "pubmed:30867528", null, "Danio rerio RNAseq singleHeart 1dpf wt 1", "GSM3131209", null, "tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "Danio rerio RNAseq singleHeart 1dpf wt 1", "RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format", "heart", null, "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "Zebrafish Danio rerio  were housed at 27.5\u00b0C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.", "strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+", "GSM3131209", "GSM3131209: Danio rerio RNAseq singleHeart 1dpf wt 1; Danio rerio; RNA Seq", "GSM3131209", null, "1", "RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation", "GEO Accession:GSM3131209", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP144601", null, null, "W_1_1_NDCII_sample_0002.fastq.gz", "fastq", 115972945.0, 1548390.0, "GSM3131209 r1", "0:74.90", "A:39437412;C:19997472;G:22424748;T:34023469;N:89844", 74, null, null, null, 39437412, 19997472, 22424748, 34023469, 89844, "SRX4041461", "SRS3258961", "SRA699717", "GEO", "Molecular Biology, Radboud University", 1, 0.81745, null, 0.22051, null, 0.87746, null, 0.55768, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "rrna_depletion", "ribozero", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-05-04", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [51190, "SRR8592250", "SRX5392462", "SRS4380285", "SRP186305", "PRJNA522917", "Pbx4 limits vertebrate heart size and promotes pharyngeal arch artery development through partitioning progenitor fates within the second heart field and restricting proliferation", "GSE126647", "Transcriptome Analysis", "Development of the vertebrate heart requires the appropriate integration of temporally distinct differentiating progenitor populations. While factors that promote accrual of later differentiating second heart field SHF derived cells to the outflow tract OFT have been intensively investigated  few signals are understood that specifically restrict the size of the vertebrate OFT. Here  we show that improper specification and proliferation of SHF progenitors in zebrafish lazarus lzr mutants  which lack the transcription factor Pbx4  produces enlarged hearts with a specific increase in ventricular cardiomyocytes and smooth muscle cells within the OFT. Specifically  optogenetic lineage tracing demonstrates Pbx4 initially promotes the proper partitioning of the SHF into anterior progenitors  which contribute to the OFT  and adjacent endothelial cell progenitors  which contribute to posterior pharyngeal arch arteries. Subsequently  Pbx4 also limits the size of the SHF through repressing SHF progenitor proliferation. Single cell RNA sequencing of nkx2.5+ cells revealed that the enlarged SHF progenitor population within Pbx4 deficient embryos assimilates characteristics of normally distinct proliferative and more anterior  differentiated cardiomyocyte populations. Therefore  the generation of proper OFT size and great arteries in vertebrates requires Pbx dependent stratification of unique progenitor differentiation states to facilitate homeotic like transformations and limit progenitor production within the SHF. Overall design: To determine the effects of Pbx4 loss on cardiac progenitors and differentiated cardiomyocytes  we utilized  single cell RNA Seq scRNA Seq data sets collected from  control and Pbx4 depleted embryos nkx2.5:ZsYellow+ cells at 28 hours post ferlilization. The 10x Genomics platform was used for these studies version 2 library chemistry.", null, "pubmed:32094112", null, "Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq", "GSM3610371", null, "source name:Pbx4 depleted nkx2.5:ZsYellow+ cells|strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells", "Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq", "Illumina HiSeq2500 used for basecalling CellRanger software package used for alignment  filtering  barcode reading prior to post processing with ICGS in AltAnalyze. Genome build: GRCz10/danRer10 Supplementary files format and content: 10X Genomics Chromium Raw Gene BC Cellular Barcodes barcode.tsv  Genes genes.tsv  and Matrix matrix.mtx", "Pbx4 depleted nkx2.5:ZsYellow+ cells", null, "Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver  2016 with the following modifications  approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank\u2019s Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 \u00b5l HBSS and dissociation was initiated by adding 60 \u00b5l Liberase Roche. Embryos were deyolked by pipetting up and down  first with a p1000 tip and subsequently with a p100 tip  as described by Samsa et al.  2016. Following yolk removal  embryos were incubated at 32.5\u00b0C. To facilitate dissociation  embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5\u00b0C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation  cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4\u00b0C. The supernatant was discarded and the resulting pellets were resuspended in 500 \u00b5l of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 \u00b5m strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 \u00b5m nozzle and a gating strategy as described by Samsa et al.  2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer.\u00a0Using this library  we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry", null, "strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells", "GSM3610371", "GSM3610371: Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq; Danio rerio; RNA Seq", "GSM3610371", null, "1", "Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver  2016 with the following modifications  approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank's Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 \u00b5l HBSS and dissociation was initiated by adding 60 \u00b5l Liberase Roche. Embryos were deyolked by pipetting up and down  first with a p1000 tip and subsequently with a p100 tip  as described by Samsa et al.  2016. Following yolk removal  embryos were incubated at 32.5\u00b0C. To facilitate dissociation  embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5\u00b0C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation  cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4\u00b0C. The supernatant was discarded and the resulting pellets were resuspended in 500 \u00b5l of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 \u00b5m strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 \u00b5m nozzle and a gating strategy as described by Samsa et al.  2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer.\u00a0Using this library  we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry", "GEO Accession:GSM3610371", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP186305", null, "loader:fastq load.py|options:  platform=Illumina   readTypes=TTB   read1PairFiles=10X PBX4 mo injected 3zf S2 L001 I1 001.fastq.gz   read2PairFiles=10X PBX4 mo injected 3zf S2 L001 R1 001.fastq.gz   read3PairFiles=10X PBX4 mo injected 3zf S2 L001 R2 001.fastq.gz", "10X_PBX4_mo_injected_3zf_S2_L001_I1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_R1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_R2_001.fastq.gz", "fastq fastq fastq", 13771731610.0, 75668855.0, "GSM3610371 r1", "0:8 1:27 2:147", "A:3868981340;C:3004344480;G:3173242889;T:3705905113;N:19257788", 8, 27, 147, null, 3868981340, 3004344480, 3173242889, 3705905113, 19257788, "SRX5392462", "SRS4380285", "SRA850447", "GEO", "Nathan Salomonis, Biomedical Informatics, Cincinnati Children's Hospital", 1, 0.91532, null, 0.07049, null, 0.82722, null, 0.50962, null, 147, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2019-02-15", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [51191, "SRR8592251", "SRX5392462", "SRS4380285", "SRP186305", "PRJNA522917", "Pbx4 limits vertebrate heart size and promotes pharyngeal arch artery development through partitioning progenitor fates within the second heart field and restricting proliferation", "GSE126647", "Transcriptome Analysis", "Development of the vertebrate heart requires the appropriate integration of temporally distinct differentiating progenitor populations. While factors that promote accrual of later differentiating second heart field SHF derived cells to the outflow tract OFT have been intensively investigated  few signals are understood that specifically restrict the size of the vertebrate OFT. Here  we show that improper specification and proliferation of SHF progenitors in zebrafish lazarus lzr mutants  which lack the transcription factor Pbx4  produces enlarged hearts with a specific increase in ventricular cardiomyocytes and smooth muscle cells within the OFT. Specifically  optogenetic lineage tracing demonstrates Pbx4 initially promotes the proper partitioning of the SHF into anterior progenitors  which contribute to the OFT  and adjacent endothelial cell progenitors  which contribute to posterior pharyngeal arch arteries. Subsequently  Pbx4 also limits the size of the SHF through repressing SHF progenitor proliferation. Single cell RNA sequencing of nkx2.5+ cells revealed that the enlarged SHF progenitor population within Pbx4 deficient embryos assimilates characteristics of normally distinct proliferative and more anterior  differentiated cardiomyocyte populations. Therefore  the generation of proper OFT size and great arteries in vertebrates requires Pbx dependent stratification of unique progenitor differentiation states to facilitate homeotic like transformations and limit progenitor production within the SHF. Overall design: To determine the effects of Pbx4 loss on cardiac progenitors and differentiated cardiomyocytes  we utilized  single cell RNA Seq scRNA Seq data sets collected from  control and Pbx4 depleted embryos nkx2.5:ZsYellow+ cells at 28 hours post ferlilization. The 10x Genomics platform was used for these studies version 2 library chemistry.", null, "pubmed:32094112", null, "Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq", "GSM3610371", null, "source name:Pbx4 depleted nkx2.5:ZsYellow+ cells|strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells", "Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq", "Illumina HiSeq2500 used for basecalling CellRanger software package used for alignment  filtering  barcode reading prior to post processing with ICGS in AltAnalyze. Genome build: GRCz10/danRer10 Supplementary files format and content: 10X Genomics Chromium Raw Gene BC Cellular Barcodes barcode.tsv  Genes genes.tsv  and Matrix matrix.mtx", "Pbx4 depleted nkx2.5:ZsYellow+ cells", null, "Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver  2016 with the following modifications  approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank\u2019s Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 \u00b5l HBSS and dissociation was initiated by adding 60 \u00b5l Liberase Roche. Embryos were deyolked by pipetting up and down  first with a p1000 tip and subsequently with a p100 tip  as described by Samsa et al.  2016. Following yolk removal  embryos were incubated at 32.5\u00b0C. To facilitate dissociation  embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5\u00b0C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation  cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4\u00b0C. The supernatant was discarded and the resulting pellets were resuspended in 500 \u00b5l of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 \u00b5m strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 \u00b5m nozzle and a gating strategy as described by Samsa et al.  2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer.\u00a0Using this library  we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry", null, "strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells", "GSM3610371", "GSM3610371: Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq; Danio rerio; RNA Seq", "GSM3610371", null, "1", "Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver  2016 with the following modifications  approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank's Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 \u00b5l HBSS and dissociation was initiated by adding 60 \u00b5l Liberase Roche. Embryos were deyolked by pipetting up and down  first with a p1000 tip and subsequently with a p100 tip  as described by Samsa et al.  2016. Following yolk removal  embryos were incubated at 32.5\u00b0C. To facilitate dissociation  embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5\u00b0C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation  cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4\u00b0C. The supernatant was discarded and the resulting pellets were resuspended in 500 \u00b5l of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 \u00b5m strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 \u00b5m nozzle and a gating strategy as described by Samsa et al.  2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer.\u00a0Using this library  we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry", "GEO Accession:GSM3610371", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP186305", null, "loader:fastq load.py|options:  platform=Illumina   readTypes=TTB   read1PairFiles=10X PBX4 mo injected 3zf S2 L002 I1 001.fastq.gz   read2PairFiles=10X PBX4 mo injected 3zf S2 L002 R1 001.fastq.gz   read3PairFiles=10X PBX4 mo injected 3zf S2 L002 R2 001.fastq.gz", "10X_PBX4_mo_injected_3zf_S2_L002_I1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_R1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_R2_001.fastq.gz", "fastq fastq fastq", 13960104704.0, 76703872.0, "GSM3610371 r2", "0:8 1:27 2:147", "A:3921736827;C:3045954411;G:3216708567;T:3758217760;N:17487139", 8, 27, 147, null, 3921736827, 3045954411, 3216708567, 3758217760, 17487139, "SRX5392462", "SRS4380285", "SRA850447", "GEO", "Nathan Salomonis, Biomedical Informatics, Cincinnati Children's Hospital", 1, 0.91469, null, 0.06915, null, 0.82747, null, 0.49959, null, 147, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2019-02-15", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [53021, "SRR9662018", "SRX6422894", "SRS5079684", "SRP213938", "PRJNA553572", "A map of cis regulatory elements and 3D genome structures in zebrafish", "GSE134055", "Other", "The zebrafish has been widely used for the study of human disease and development  as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome  however  has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects  we performed RNA seq  ATAC seq  ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall  we have identified 235 596 cis regulatory elements  which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish  human  and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore  through the analysis of Hi C data in zebrafish brain and muscle  we observed different levels of 3D genome organization  including compartment  topological associating domains TADs  and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and  embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3  RNA Seq  11 of them were examined using ATAC seq  WGBS and ChIP seq H3K9me3 and H3K9me2  and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that  for the samples GSM4661977 GSM4662088  [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records.", null, "pubmed:33239788;pubmed:35649578", null, "YueLab RNA Seq Heart rep2", "GSM3934886", null, "source name:Tissue|strain:Tuebingen|tissue:Heart", "YueLab RNA Seq Heart rep2", "RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following  setting: ChIP seq q value <10e 2  p value<10e 5  Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged", "Tissue", null, "For each RNA seq experiment  the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk  ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron  green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol\u00ae according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer\u2019s protocol. Briefly  polyA RNA was purified from 1000\u00a0ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented  then followed by reverse transcription  end repair  adenylation  adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina.", "Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions", "strain:Tuebingen|tissue:Heart", "GSM3934886", "GSM3934886: YueLab RNA Seq Heart rep2; Danio rerio; RNA Seq", "GSM3934886", null, "1", "For each RNA seq experiment  the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk  ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron  green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol\u00ae according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly  polyA RNA was purified from 1000\u00a0ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented  then followed by reverse transcription  end repair  adenylation  adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina.", "GEO Accession:GSM3934886", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer", null, "SRP213938", null, null, "YueLab-RNA-Seq-Heart-rep2_1.fastq.gz YueLab-RNA-Seq-Heart-rep2_2.fastq.gz", "fastq fastq", 3738852700.0, 37388527.0, "GSM3934886 r1", "0:50 1:50", "A:908524568;C:968345371;G:992587651;T:864823167;N:4571943", 50, 50, null, null, 908524568, 968345371, 992587651, 864823167, 4571943, "SRX6422894", "SRS5079684", "SRA919194", "GEO", "Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine", 2, 0.8454, 0.84237, 0.22307, 0.21683, 0.84082, 0.84053, 0.63946, 0.67201, 50, 50, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2019-07-09", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [53022, "SRR9662017", "SRX6422893", "SRS5079682", "SRP213938", "PRJNA553572", "A map of cis regulatory elements and 3D genome structures in zebrafish", "GSE134055", "Other", "The zebrafish has been widely used for the study of human disease and development  as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome  however  has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects  we performed RNA seq  ATAC seq  ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall  we have identified 235 596 cis regulatory elements  which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish  human  and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore  through the analysis of Hi C data in zebrafish brain and muscle  we observed different levels of 3D genome organization  including compartment  topological associating domains TADs  and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and  embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3  RNA Seq  11 of them were examined using ATAC seq  WGBS and ChIP seq H3K9me3 and H3K9me2  and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that  for the samples GSM4661977 GSM4662088  [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records.", null, "pubmed:33239788;pubmed:35649578", null, "YueLab RNA Seq Heart rep1", "GSM3934885", null, "source name:Tissue|strain:Tuebingen|tissue:Heart", "YueLab RNA Seq Heart rep1", "RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following  setting: ChIP seq q value <10e 2  p value<10e 5  Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged", "Tissue", null, "For each RNA seq experiment  the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk  ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron  green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol\u00ae according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer\u2019s protocol. Briefly  polyA RNA was purified from 1000\u00a0ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented  then followed by reverse transcription  end repair  adenylation  adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina.", "Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions", "strain:Tuebingen|tissue:Heart", "GSM3934885", "GSM3934885: YueLab RNA Seq Heart rep1; Danio rerio; RNA Seq", "GSM3934885", null, "1", "For each RNA seq experiment  the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk  ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron  green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol\u00ae according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly  polyA RNA was purified from 1000\u00a0ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented  then followed by reverse transcription  end repair  adenylation  adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina.", "GEO Accession:GSM3934885", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer", null, "SRP213938", null, null, "YueLab-RNA-Seq-Heart-rep1_1.fastq.gz YueLab-RNA-Seq-Heart-rep1_2.fastq.gz", "fastq fastq", 3840548749.0, 31797756.0, "GSM3934885 r1", "0:60.46 1:60.32", "A:1037745400;C:853066216;G:864291073;T:1085389048;N:57012", 60, 60, null, null, 1037745400, 853066216, 864291073, 1085389048, 57012, "SRX6422893", "SRS5079682", "SRA919194", "GEO", "Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine", 2, 0.97577, 0.98167, 0.10912, 0.10881, 0.76118, 0.76526, 0.54037, 0.54676, 60, 60, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2019-07-09", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68780, "SRR18192263", "SRX14338908", "SRS12152837", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf D12D23 1", "GSM5929627", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf D12D23 1", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929627", "GSM5929627: ventral EC 28hpf D12D23 1; Danio rerio; RNA Seq", "GSM5929627 r1", "GSM5929627", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M12D23_1_1.fq.gz M12D23_1_2.fq.gz", "fastq fastq", 3170077200.0, 10566924.0, "GSM5929627 r1", "0:150 1:150", "A:895284956;C:687951853;G:714718914;T:872030334;N:91143", 150, 150, null, null, 895284956, 687951853, 714718914, 872030334, 91143, "SRX14338908", "SRS12152837", null, null, "Wen's lab, LIFS, HKUST", 2, 0.86937, 0.859, 0.06355, 0.0627, 0.87663, 0.87969, 0.54768, 0.54015, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68781, "SRR18192264", "SRX14338907", "SRS12152836", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M12D9 2", "GSM5929626", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M12D9 2", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929626", "GSM5929626: ventral EC 28hpf M12D9 2; Danio rerio; RNA Seq", "GSM5929626 r1", "GSM5929626", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M12D9_2_1.fq.gz M12D9_2_2.fq.gz", "fastq fastq", 2821946100.0, 9406487.0, "GSM5929626 r1", "0:150 1:150", "A:833459321;C:543141040;G:577507179;T:867795846;N:42714", 150, 150, null, null, 833459321, 543141040, 577507179, 867795846, 42714, "SRX14338907", "SRS12152836", null, null, "Wen's lab, LIFS, HKUST", 2, 0.73514, 0.75198, 0.03754, 0.03907, 0.89838, 0.89558, 0.47184, 0.47431, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68782, "SRR18192268", "SRX14338906", "SRS12152835", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M12D24 1", "GSM5929625", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M12D24 1", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929625", "GSM5929625: ventral EC 28hpf M12D24 1; Danio rerio; RNA Seq", "GSM5929625 r1", "GSM5929625", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M12D24_1_1.fq.gz M12D24_1_2.fq.gz", "fastq fastq", 3437508900.0, 11458363.0, "GSM5929625 r1", "0:150 1:150", "A:949393206;C:771172192;G:792724386;T:924119993;N:99123", 150, 150, null, null, 949393206, 771172192, 792724386, 924119993, 99123, "SRX14338906", "SRS12152835", null, null, "Wen's lab, LIFS, HKUST", 2, 0.8808, 0.87092, 0.05011, 0.04935, 0.89451, 0.89593, 0.51071, 0.5107, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68783, "SRR18192265", "SRX14338905", "SRS12152834", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M12D22 7", "GSM5929624", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M12D22 7", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929624", "GSM5929624: ventral EC 28hpf M12D22 7; Danio rerio; RNA Seq", "GSM5929624 r1", "GSM5929624", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M12D22_7_1.fq.gz M12D22_7_2.fq.gz", "fastq fastq", 3353765100.0, 11179217.0, "GSM5929624 r1", "0:150 1:150", "A:912815682;C:764078293;G:783280096;T:893499532;N:91497", 150, 150, null, null, 912815682, 764078293, 783280096, 893499532, 91497, "SRX14338905", "SRS12152834", null, null, "Wen's lab, LIFS, HKUST", 2, 0.92895, 0.92193, 0.06189, 0.05719, 0.95674, 0.95751, 0.43458, 0.48713, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68784, "SRR18192266", "SRX14338904", "SRS12152833", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M12D22 5", "GSM5929623", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M12D22 5", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929623", "GSM5929623: ventral EC 28hpf M12D22 5; Danio rerio; RNA Seq", "GSM5929623 r1", "GSM5929623", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M12D22_5_1.fq.gz M12D22_5_2.fq.gz", "fastq fastq", 2976989100.0, 9923297.0, "GSM5929623 r1", "0:150 1:150", "A:827316613;C:664047061;G:674937107;T:810600886;N:87433", 150, 150, null, null, 827316613, 664047061, 674937107, 810600886, 87433, "SRX14338904", "SRS12152833", null, null, "Wen's lab, LIFS, HKUST", 2, 0.93146, 0.93345, 0.06672, 0.0674, 0.8788, 0.87988, 0.5154, 0.53867, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68785, "SRR18192267", "SRX14338903", "SRS12152832", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M12D2 2", "GSM5929622", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M12D2 2", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929622", "GSM5929622: ventral EC 28hpf M12D2 2; Danio rerio; RNA Seq", "GSM5929622 r1", "GSM5929622", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M12D2_2_1.fq.gz M12D2_2_2.fq.gz", "fastq fastq", 3372720300.0, 11242401.0, "GSM5929622 r1", "0:150 1:150", "A:988221703;C:669226615;G:703188465;T:1012044907;N:38610", 150, 150, null, null, 988221703, 669226615, 703188465, 1012044907, 38610, "SRX14338903", "SRS12152832", null, null, "Wen's lab, LIFS, HKUST", 2, 0.86571, 0.86595, 0.0657, 0.06575, 0.87564, 0.87614, 0.53669, 0.53356, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68786, "SRR18192269", "SRX14338902", "SRS12152831", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M11D13 2", "GSM5929621", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M11D13 2", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929621", "GSM5929621: ventral EC 28hpf M11D13 2; Danio rerio; RNA Seq", "GSM5929621 r1", "GSM5929621", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M11D13_2_1.fq.gz M11D13_2_2.fq.gz", "fastq fastq", 2967463200.0, 9891544.0, "GSM5929621 r1", "0:150 1:150", "A:856598489;C:601958772;G:626644284;T:882214582;N:47073", 150, 150, null, null, 856598489, 601958772, 626644284, 882214582, 47073, "SRX14338902", "SRS12152831", null, null, "Wen's lab, LIFS, HKUST", 2, 0.67923, 0.67722, 0.03277, 0.03284, 0.93003, 0.93008, 0.48316, 0.47991, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68787, "SRR18192270", "SRX14338901", "SRS12152830", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M10D6 1", "GSM5929620", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M10D6 1", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929620", "GSM5929620: ventral EC 28hpf M10D6 1; Danio rerio; RNA Seq", "GSM5929620 r1", "GSM5929620", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M10D6_1_1.fq.gz M10D6_1_2.fq.gz", "fastq fastq", 2572394700.0, 8574649.0, "GSM5929620 r1", "0:150 1:150", "A:768771743;C:493332801;G:503375064;T:806902578;N:12514", 150, 150, null, null, 768771743, 493332801, 503375064, 806902578, 12514, "SRX14338901", "SRS12152830", null, null, "Wen's lab, LIFS, HKUST", 2, 0.84169, 0.84187, 0.07814, 0.07802, 0.87547, 0.87495, 0.51691, 0.50228, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68788, "SRR18192271", "SRX14338900", "SRS12152829", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M9D15 5", "GSM5929619", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M9D15 5", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929619", "GSM5929619: ventral EC 28hpf M9D15 5; Danio rerio; RNA Seq", "GSM5929619 r1", "GSM5929619", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M9D15_5_1.fq.gz M9D15_5_2.fq.gz", "fastq fastq", 2850079800.0, 9500266.0, "GSM5929619 r1", "0:150 1:150", "A:810682308;C:581612893;G:631575261;T:826195519;N:13819", 150, 150, null, null, 810682308, 581612893, 631575261, 826195519, 13819, "SRX14338900", "SRS12152829", null, null, "Wen's lab, LIFS, HKUST", 2, 0.89187, 0.89677, 0.07626, 0.07735, 0.94953, 0.9499, 0.52273, 0.51981, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68789, "SRR18192272", "SRX14338899", "SRS12152828", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M9D9 4", "GSM5929618", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M9D9 4", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929618", "GSM5929618: ventral EC 28hpf M9D9 4; Danio rerio; RNA Seq", "GSM5929618 r1", "GSM5929618", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M9D9_4_1.fq.gz M9D9_4_2.fq.gz", "fastq fastq", 2479911300.0, 8266371.0, "GSM5929618 r1", "0:150 1:150", "A:708753950;C:500666505;G:524945871;T:745538353;N:6621", 150, 150, null, null, 708753950, 500666505, 524945871, 745538353, 6621, "SRX14338899", "SRS12152828", null, null, "Wen's lab, LIFS, HKUST", 2, 0.87067, 0.87069, 0.03121, 0.0308, 0.93012, 0.93003, 0.46455, 0.48374, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68790, "SRR18192276", "SRX14338898", "SRS12152827", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M8D26 7", "GSM5929617", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M8D26 7", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929617", "GSM5929617: ventral EC 28hpf M8D26 7; Danio rerio; RNA Seq", "GSM5929617 r1", "GSM5929617", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M8D26_7_1.fq.gz M8D26_7_2.fq.gz", "fastq fastq", 2345052000.0, 7816840.0, "GSM5929617 r1", "0:150 1:150", "A:688980894;C:460051627;G:493463648;T:702534414;N:21417", 150, 150, null, null, 688980894, 460051627, 493463648, 702534414, 21417, "SRX14338898", "SRS12152827", null, null, "Wen's lab, LIFS, HKUST", 2, 0.86279, 0.86348, 0.08038, 0.08074, 0.89254, 0.89221, 0.55795, 0.55419, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68791, "SRR18192273", "SRX14338897", "SRS12152826", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "ventral EC 28hpf M8D19 6", "GSM5929616", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "ventral EC 28hpf M8D19 6", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs", "GSM5929616", "GSM5929616: ventral EC 28hpf M8D19 6; Danio rerio; RNA Seq", "GSM5929616 r1", "GSM5929616", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "M8D19_6_1.fq.gz M8D19_6_2.fq.gz", "fastq fastq", 2798831400.0, 9329438.0, "GSM5929616 r1", "0:150 1:150", "A:805491779;C:569610640;G:603975629;T:819132101;N:621251", 150, 150, null, null, 805491779, 569610640, 603975629, 819132101, 621251, "SRX14338897", "SRS12152826", null, null, "Wen's lab, LIFS, HKUST", 2, 0.91139, 0.91351, 0.08225, 0.08186, 0.94284, 0.94302, 0.5336, 0.44266, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68792, "SRR18192274", "SRX14338896", "SRS12152825", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 3 8", "GSM5929615", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 3 8", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929615", "GSM5929615: dorsal EC 28hpf 3 8; Danio rerio; RNA Seq", "GSM5929615 r1", "GSM5929615", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s3-8_FRRS190258335-1a_1.fq.gz s3-8_FRRS190258335-1a_2.fq.gz", "fastq fastq", 2604747900.0, 8682493.0, "GSM5929615 r1", "0:150 1:150", "A:736722719;C:533523721;G:576469454;T:757971426;N:60580", 150, 150, null, null, 736722719, 533523721, 576469454, 757971426, 60580, "SRX14338896", "SRS12152825", null, null, "Wen's lab, LIFS, HKUST", 2, 0.91825, 0.91828, 0.10627, 0.1087, 0.89599, 0.89729, 0.51202, 0.50855, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68793, "SRR18192275", "SRX14338895", "SRS12152824", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 3 6", "GSM5929614", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 3 6", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929614", "GSM5929614: dorsal EC 28hpf 3 6; Danio rerio; RNA Seq", "GSM5929614 r1", "GSM5929614", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s3-6_FRRS190258334-1a_1.fq.gz s3-6_FRRS190258334-1a_2.fq.gz", "fastq fastq", 2910067200.0, 9700224.0, "GSM5929614 r1", "0:150 1:150", "A:836341596;C:579661336;G:634991448;T:859065707;N:7113", 150, 150, null, null, 836341596, 579661336, 634991448, 859065707, 7113, "SRX14338895", "SRS12152824", null, null, "Wen's lab, LIFS, HKUST", 2, 0.90842, 0.91323, 0.11388, 0.11761, 0.87657, 0.87771, 0.5409, 0.44794, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68794, "SRR18192277", "SRX14338894", "SRS12152823", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 3 5", "GSM5929613", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 3 5", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929613", "GSM5929613: dorsal EC 28hpf 3 5; Danio rerio; RNA Seq", "GSM5929613 r1", "GSM5929613", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s3-5_FRRS190258333-1a_1.fq.gz s3-5_FRRS190258333-1a_2.fq.gz", "fastq fastq", 2586321600.0, 8621072.0, "GSM5929613 r1", "0:150 1:150", "A:764349209;C:481474676;G:551762215;T:788729235;N:6265", 150, 150, null, null, 764349209, 481474676, 551762215, 788729235, 6265, "SRX14338894", "SRS12152823", null, null, "Wen's lab, LIFS, HKUST", 2, 0.85465, 0.86431, 0.14932, 0.14961, 0.88024, 0.8803, 0.45329, 0.44805, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68795, "SRR18192278", "SRX14338893", "SRS12152822", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 3 4", "GSM5929612", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 3 4", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929612", "GSM5929612: dorsal EC 28hpf 3 4; Danio rerio; RNA Seq", "GSM5929612 r1", "GSM5929612", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s3-4_FRRS190258332-1a_1.fq.gz s3-4_FRRS190258332-1a_2.fq.gz", "fastq fastq", 2674832100.0, 8916107.0, "GSM5929612 r1", "0:150 1:150", "A:777258461;C:511597382;G:583618812;T:802350928;N:6517", 150, 150, null, null, 777258461, 511597382, 583618812, 802350928, 6517, "SRX14338893", "SRS12152822", null, null, "Wen's lab, LIFS, HKUST", 2, 0.8804, 0.89063, 0.15365, 0.15632, 0.91309, 0.91467, 0.54094, 0.5416, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68796, "SRR18192279", "SRX14338892", "SRS12152821", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 3 3", "GSM5929611", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 3 3", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929611", "GSM5929611: dorsal EC 28hpf 3 3; Danio rerio; RNA Seq", "GSM5929611 r1", "GSM5929611", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s3-3_FRRS190258331-1a_1.fq.gz s3-3_FRRS190258331-1a_2.fq.gz", "fastq fastq", 2488293600.0, 8294312.0, "GSM5929611 r1", "0:150 1:150", "A:719382089;C:479754756;G:546445571;T:742705113;N:6071", 150, 150, null, null, 719382089, 479754756, 546445571, 742705113, 6071, "SRX14338892", "SRS12152821", null, null, "Wen's lab, LIFS, HKUST", 2, 0.8796, 0.88849, 0.12956, 0.13203, 0.90343, 0.90418, 0.57666, 0.57396, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68797, "SRR18192280", "SRX14338891", "SRS12152820", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 2 8", "GSM5929610", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 2 8", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929610", "GSM5929610: dorsal EC 28hpf 2 8; Danio rerio; RNA Seq", "GSM5929610 r1", "GSM5929610", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s2-8_FRRS190258330-1a_1.fq.gz s2-8_FRRS190258330-1a_2.fq.gz", "fastq fastq", 2582877000.0, 8609590.0, "GSM5929610 r1", "0:150 1:150", "A:729178468;C:509541231;G:591991165;T:752108619;N:57517", 150, 150, null, null, 729178468, 509541231, 591991165, 752108619, 57517, "SRX14338891", "SRS12152820", null, null, "Wen's lab, LIFS, HKUST", 2, 0.86946, 0.88482, 0.13171, 0.13542, 0.8999, 0.90011, 0.56683, 0.57631, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68798, "SRR18192281", "SRX14338890", "SRS12152819", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 2 7", "GSM5929609", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 2 7", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929609", "GSM5929609: dorsal EC 28hpf 2 7; Danio rerio; RNA Seq", "GSM5929609 r1", "GSM5929609", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s2-7_FRRS190258329-1a_1.fq.gz s2-7_FRRS190258329-1a_2.fq.gz", "fastq fastq", 2490208800.0, 8300696.0, "GSM5929609 r1", "0:150 1:150", "A:720296065;C:474166353;G:564479960;T:731209983;N:56439", 150, 150, null, null, 720296065, 474166353, 564479960, 731209983, 56439, "SRX14338890", "SRS12152819", null, null, "Wen's lab, LIFS, HKUST", 2, 0.83746, 0.85625, 0.15921, 0.1621, 0.90339, 0.90524, 0.62165, 0.63076, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68799, "SRR18192282", "SRX14338889", "SRS12152818", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 2 5", "GSM5929608", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 2 5", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929608", "GSM5929608: dorsal EC 28hpf 2 5; Danio rerio; RNA Seq", "GSM5929608 r1", "GSM5929608", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s2-5_FRRS190258327-1a_1.fq.gz s2-5_FRRS190258327-1a_2.fq.gz", "fastq fastq", 2749806000.0, 9166020.0, "GSM5929608 r1", "0:150 1:150", "A:784223138;C:532982851;G:625789164;T:806748588;N:62259", 150, 150, null, null, 784223138, 532982851, 625789164, 806748588, 62259, "SRX14338889", "SRS12152818", null, null, "Wen's lab, LIFS, HKUST", 2, 0.85224, 0.86654, 0.14294, 0.14701, 0.92583, 0.92632, 0.61496, 0.6108, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68800, "SRR18192283", "SRX14338888", "SRS12152817", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 2 1", "GSM5929607", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 2 1", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929607", "GSM5929607: dorsal EC 28hpf 2 1; Danio rerio; RNA Seq", "GSM5929607 r1", "GSM5929607", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s2-1_FRRS190258325-1a_1.fq.gz s2-1_FRRS190258325-1a_2.fq.gz", "fastq fastq", 2604154800.0, 8680516.0, "GSM5929607 r1", "0:150 1:150", "A:736307297;C:510001632;G:599495622;T:758291155;N:59094", 150, 150, null, null, 736307297, 510001632, 599495622, 758291155, 59094, "SRX14338888", "SRS12152817", null, null, "Wen's lab, LIFS, HKUST", 2, 0.84706, 0.8645, 0.12467, 0.12748, 0.92021, 0.92058, 0.57173, 0.57155, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [68801, "SRR18192284", "SRX14338887", "SRS12152816", "SRP362184", "PRJNA812001", "scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish", "GSE197757", "Transcriptome Analysis", "In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish  we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion  and then performed scRNA sequencing. These single ECs were isolated at two different time points  21 hpf and 28 hpf  when the lumen of the DA is established and the EHT begins   respectively. Overall design: Spatial photoconversion DA roof versus DA floor  cell dissociation and mannual picking of photoconverted ECs", null, "pubmed:35333649", null, "dorsal EC 28hpf 1 6", "GSM5929606", null, "source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "dorsal EC 28hpf 1 6", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore  q 20   phred33   stringency 5   length 20  e 0.1   paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Trunk DA endothelium", null, "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs", "GSM5929606", "GSM5929606: dorsal EC 28hpf 1 6; Danio rerio; RNA Seq", "GSM5929606 r1", "GSM5929606", "1", "Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope  then washed with 2% BSA/PBS  and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP362184", null, "loader:fastq load.py", "s1-6_FRRS190258324-1a_1.fq.gz s1-6_FRRS190258324-1a_2.fq.gz", "fastq fastq", 2584733400.0, 8615778.0, "GSM5929606 r1", "0:150 1:150", "A:744541937;C:491678417;G:564885142;T:783570500;N:57404", 150, 150, null, null, 744541937, 491678417, 564885142, 783570500, 57404, "SRX14338887", "SRS12152816", null, null, "Wen's lab, LIFS, HKUST", 2, 0.88478, 0.88951, 0.17027, 0.17195, 0.91396, 0.91514, 0.62615, 0.6243, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2022-03-02", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"]], "truncated": false, "filtered_table_rows_count": 60, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "Pharyngula", "p1": "Heart"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "cDNA", "label": "cDNA", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&experiment.library_selection=cDNA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 32, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 28, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "Embryo", "label": "Embryo", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "Pharyngula", "label": "Pharyngula", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Heart", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "Cardiovascular System", "label": "Cardiovascular System", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&tissue_curation_coarse=Cardiovascular+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "Heart", "label": "Heart", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart", "results": [{"value": "smartseq", "label": "smartseq", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&technology=smartseq", "selected": false}, {"value": "celseq", "label": "celseq", "count": 17, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&technology=celseq", "selected": false}, {"value": "unknown", "label": "unknown", "count": 13, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&technology=bulk", "selected": false}, {"value": "10x", "label": "10x", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Pharyngula&tissue_curation=Heart&technology=10x", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 110.4972609973629}