{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Multi-stage\" and technology = \"smartseq\"", "rows": [[24927, "SRR25557778", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L001_R1_001.fastq.gz", "fastq", 420092501.0, 5668059.0, "GSM7688794 r1", "0:74.12", "A:113006440;C:96725832;G:99320773;T:110915967;N:123489", 74, null, null, null, 113006440, 96725832, 99320773, 110915967, 123489, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94757, null, 0.06229, null, 0.72364, null, 0.46676, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24928, "SRR25557779", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L002_R1_001.fastq.gz", "fastq", 421869780.0, 5690053.0, "GSM7688794 r2", "0:74.14", "A:113530489;C:97144227;G:99697959;T:111388539;N:108566", 74, null, null, null, 113530489, 97144227, 99697959, 111388539, 108566, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94921, null, 0.06226, null, 0.72462, null, 0.4738, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24929, "SRR25557780", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L003_R1_001.fastq.gz", "fastq", 425064659.0, 5734041.0, "GSM7688794 r3", "0:74.13", "A:114342253;C:97873100;G:100532599;T:112196433;N:120274", 74, null, null, null, 114342253, 97873100, 100532599, 112196433, 120274, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94886, null, 0.06112, null, 0.72425, null, 0.47055, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24930, "SRR25557781", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L004_R1_001.fastq.gz", "fastq", 416990548.0, 5624902.0, "GSM7688794 r4", "0:74.13", "A:112153356;C:96009158;G:98613145;T:110097476;N:117413", 74, null, null, null, 112153356, 96009158, 98613145, 110097476, 117413, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94869, null, 0.06229, null, 0.72506, null, 0.47222, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24931, "SRR25557782", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L001_R1_001.fastq.gz", "fastq", 434485284.0, 5881416.0, "GSM7688793 r1", "0:73.87", "A:116640351;C:100176557;G:102659919;T:114799536;N:208921", 73, null, null, null, 116640351, 100176557, 102659919, 114799536, 208921, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94533, null, 0.07176, null, 0.72464, null, 0.47632, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24932, "SRR25557783", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L002_R1_001.fastq.gz", "fastq", 435203869.0, 5886556.0, "GSM7688793 r2", "0:73.93", "A:116869356;C:100363580;G:102830644;T:114973504;N:166785", 73, null, null, null, 116869356, 100363580, 102830644, 114973504, 166785, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94542, null, 0.07203, null, 0.72421, null, 0.47733, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24933, "SRR25557784", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L003_R1_001.fastq.gz", "fastq", 439897269.0, 5951878.0, "GSM7688793 r3", "0:73.91", "A:118101648;C:101426657;G:103990006;T:116184480;N:194478", 73, null, null, null, 118101648, 101426657, 103990006, 116184480, 194478, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94486, null, 0.07224, null, 0.72448, null, 0.47915, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24934, "SRR25557785", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L004_R1_001.fastq.gz", "fastq", 431385256.0, 5836029.0, "GSM7688793 r4", "0:73.92", "A:115804970;C:99459059;G:101962932;T:113975935;N:182360", 73, null, null, null, 115804970, 99459059, 101962932, 113975935, 182360, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94432, null, 0.07229, null, 0.7261, null, 0.47463, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24935, "SRR25557786", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L001_R1_001.fastq.gz", "fastq", 513309395.0, 6929648.0, "GSM7688792 r1", "0:74.07", "A:137428462;C:118688804;G:122019962;T:134991729;N:180438", 74, null, null, null, 137428462, 118688804, 122019962, 134991729, 180438, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94188, null, 0.07029, null, 0.73772, null, 0.47692, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24936, "SRR25557787", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L002_R1_001.fastq.gz", "fastq", 517356735.0, 6982196.0, "GSM7688792 r2", "0:74.10", "A:138524037;C:119650852;G:122965491;T:136056171;N:160184", 74, null, null, null, 138524037, 119650852, 122965491, 136056171, 160184, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94281, null, 0.06967, null, 0.73963, null, 0.48142, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24937, "SRR25557788", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L003_R1_001.fastq.gz", "fastq", 519422328.0, 7010631.0, "GSM7688792 r3", "0:74.09", "A:139040684;C:120128748;G:123529198;T:136551898;N:171800", 74, null, null, null, 139040684, 120128748, 123529198, 136551898, 171800, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94297, null, 0.06942, null, 0.73726, null, 0.47499, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24938, "SRR25557789", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L004_R1_001.fastq.gz", "fastq", 511640294.0, 6905748.0, "GSM7688792 r4", "0:74.09", "A:136914638;C:118302866;G:121704665;T:134543505;N:174620", 74, null, null, null, 136914638, 118302866, 121704665, 134543505, 174620, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94176, null, 0.07029, null, 0.73868, null, 0.47987, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24939, "SRR25557790", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L001_R1_001.fastq.gz", "fastq", 429446821.0, 5803178.0, "GSM7688791 r1", "0:74.00", "A:114793535;C:99506379;G:102226914;T:112748761;N:171232", 74, null, null, null, 114793535, 99506379, 102226914, 112748761, 171232, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94175, null, 0.06669, null, 0.73673, null, 0.48179, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24940, "SRR25557791", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L002_R1_001.fastq.gz", "fastq", 434629893.0, 5870828.0, "GSM7688791 r2", "0:74.03", "A:116216940;C:100703527;G:103463365;T:114092681;N:153380", 74, null, null, null, 116216940, 100703527, 103463365, 114092681, 153380, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94143, null, 0.0676, null, 0.73791, null, 0.48091, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24942, "SRR25557793", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L004_R1_001.fastq.gz", "fastq", 429478475.0, 5801978.0, "GSM7688791 r4", "0:74.02", "A:114799280;C:99474677;G:102302775;T:112737475;N:164268", 74, null, null, null, 114799280, 99474677, 102302775, 112737475, 164268, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94118, null, 0.06706, null, 0.73892, null, 0.47732, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24943, "SRR25557794", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L001_R1_001.fastq.gz", "fastq", 459545188.0, 6215897.0, "GSM7688790 r1", "0:73.93", "A:121926568;C:107379723;G:110263606;T:119766429;N:208862", 73, null, null, null, 121926568, 107379723, 110263606, 119766429, 208862, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94273, null, 0.06072, null, 0.74582, null, 0.47499, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24944, "SRR25557795", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L002_R1_001.fastq.gz", "fastq", 463143624.0, 6261406.0, "GSM7688790 r2", "0:73.97", "A:122917997;C:108229793;G:111099867;T:120713978;N:181989", 73, null, null, null, 122917997, 108229793, 111099867, 120713978, 181989, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94387, null, 0.06093, null, 0.74341, null, 0.47351, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24945, "SRR25557796", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L003_R1_001.fastq.gz", "fastq", 465959664.0, 6300929.0, "GSM7688790 r3", "0:73.95", "A:123689364;C:108847593;G:111847868;T:121377463;N:197376", 73, null, null, null, 123689364, 108847593, 111847868, 121377463, 197376, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94322, null, 0.06219, null, 0.74357, null, 0.47977, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24946, "SRR25557797", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L004_R1_001.fastq.gz", "fastq", 459075430.0, 6207363.0, "GSM7688790 r4", "0:73.96", "A:121797426;C:107221116;G:110209684;T:119657308;N:189896", 73, null, null, null, 121797426, 107221116, 110209684, 119657308, 189896, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94313, null, 0.06211, null, 0.74343, null, 0.47801, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24947, "SRR25557798", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L001_R1_001.fastq.gz", "fastq", 439719566.0, 5947052.0, "GSM7688787 r1", "0:73.94", "A:117482073;C:102083665;G:104685444;T:115272860;N:195524", 73, null, null, null, 117482073, 102083665, 104685444, 115272860, 195524, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94829, null, 0.06278, null, 0.72525, null, 0.46494, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24948, "SRR25557799", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L002_R1_001.fastq.gz", "fastq", 438533503.0, 5927990.0, "GSM7688787 r2", "0:73.98", "A:117199594;C:101810881;G:104402169;T:114946611;N:174248", 73, null, null, null, 117199594, 101810881, 104402169, 114946611, 174248, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94887, null, 0.06387, null, 0.72827, null, 0.46616, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24949, "SRR25557800", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L003_R1_001.fastq.gz", "fastq", 443995554.0, 6003540.0, "GSM7688787 r3", "0:73.96", "A:118663936;C:103031716;G:105723574;T:116387834;N:188494", 73, null, null, null, 118663936, 103031716, 105723574, 116387834, 188494, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94788, null, 0.06232, null, 0.72693, null, 0.46653, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24950, "SRR25557801", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L004_R1_001.fastq.gz", "fastq", 435088869.0, 5882642.0, "GSM7688787 r4", "0:73.96", "A:116261447;C:100986653;G:103615584;T:114042354;N:182831", 73, null, null, null, 116261447, 100986653, 103615584, 114042354, 182831, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94914, null, 0.06241, null, 0.72829, null, 0.4546, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24951, "SRR25557802", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L001_R1_001.fastq.gz", "fastq", 395130702.0, 5338263.0, "GSM7688785 r1", "0:74.02", "A:107005793;C:90183031;G:92316770;T:105476481;N:148627", 74, null, null, null, 107005793, 90183031, 92316770, 105476481, 148627, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94534, null, 0.07625, null, 0.73888, null, 0.48135, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24952, "SRR25557803", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L002_R1_001.fastq.gz", "fastq", 396764458.0, 5358448.0, "GSM7688785 r2", "0:74.04", "A:107513717;C:90540282;G:92658504;T:105917444;N:134511", 74, null, null, null, 107513717, 90540282, 92658504, 105917444, 134511, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94374, null, 0.07709, null, 0.73878, null, 0.47615, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24953, "SRR25557804", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L003_R1_001.fastq.gz", "fastq", 399623551.0, 5397520.0, "GSM7688785 r3", "0:74.04", "A:108230540;C:91192011;G:93388052;T:106665106;N:147842", 74, null, null, null, 108230540, 91192011, 93388052, 106665106, 147842, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94399, null, 0.07657, null, 0.73797, null, 0.4794, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24954, "SRR25557805", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L004_R1_001.fastq.gz", "fastq", 393298978.0, 5312101.0, "GSM7688785 r4", "0:74.04", "A:106518845;C:89734564;G:91901232;T:105004490;N:139847", 74, null, null, null, 106518845, 89734564, 91901232, 105004490, 139847, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94423, null, 0.07599, null, 0.73884, null, 0.47905, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24955, "SRR25557806", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L001_R1_001.fastq.gz", "fastq", 366045799.0, 4944832.0, "GSM7688783 r1", "0:74.03", "A:98000119;C:84654222;G:86951226;T:96295351;N:144881", 74, null, null, null, 98000119, 84654222, 86951226, 96295351, 144881, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94303, null, 0.07499, null, 0.73085, null, 0.47881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24956, "SRR25557807", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L002_R1_001.fastq.gz", "fastq", 369429068.0, 4988719.0, "GSM7688783 r2", "0:74.05", "A:98907882;C:85446993;G:87729593;T:97216477;N:128123", 74, null, null, null, 98907882, 85446993, 87729593, 97216477, 128123, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94261, null, 0.07335, null, 0.72969, null, 0.47867, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24957, "SRR25557808", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L003_R1_001.fastq.gz", "fastq", 369967330.0, 4996710.0, "GSM7688783 r3", "0:74.04", "A:99035743;C:85549878;G:87926587;T:97310812;N:144310", 74, null, null, null, 99035743, 85549878, 87926587, 97310812, 144310, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94328, null, 0.0743, null, 0.73034, null, 0.47133, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24958, "SRR25557809", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L004_R1_001.fastq.gz", "fastq", 365499176.0, 4936305.0, "GSM7688783 r4", "0:74.04", "A:97825658;C:84517732;G:86863655;T:96157429;N:134702", 74, null, null, null, 97825658, 84517732, 86863655, 96157429, 134702, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94286, null, 0.07288, null, 0.72999, null, 0.4783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24959, "SRR25557810", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L001_R1_001.fastq.gz", "fastq", 488585907.0, 6585668.0, "GSM7688782 r1", "0:74.19", "A:131727468;C:112349971;G:115189425;T:129203159;N:115884", 74, null, null, null, 131727468, 112349971, 115189425, 129203159, 115884, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93794, null, 0.07381, null, 0.7315, null, 0.47355, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24960, "SRR25557811", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L002_R1_001.fastq.gz", "fastq", 493766544.0, 6653820.0, "GSM7688782 r2", "0:74.21", "A:133135166;C:113551418;G:116398455;T:130575771;N:105734", 74, null, null, null, 133135166, 113551418, 116398455, 130575771, 105734, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93729, null, 0.07312, null, 0.7307, null, 0.47966, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24961, "SRR25557812", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L003_R1_001.fastq.gz", "fastq", 494935071.0, 6670024.0, "GSM7688782 r3", "0:74.20", "A:133406912;C:113769494;G:116771560;T:130871612;N:115493", 74, null, null, null, 133406912, 113769494, 116771560, 130871612, 115493, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93847, null, 0.07383, null, 0.73194, null, 0.47646, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24962, "SRR25557813", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L004_R1_001.fastq.gz", "fastq", 487644286.0, 6572100.0, "GSM7688782 r4", "0:74.20", "A:131423055;C:112092623;G:115067911;T:128945959;N:114738", 74, null, null, null, 131423055, 112092623, 115067911, 128945959, 114738, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93708, null, 0.0732, null, 0.73186, null, 0.4781, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24963, "SRR25557814", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L001_R1_001.fastq.gz", "fastq", 419048369.0, 5664168.0, "GSM7688781 r1", "0:73.98", "A:111569757;C:97553687;G:100228004;T:109523480;N:173441", 73, null, null, null, 111569757, 97553687, 100228004, 109523480, 173441, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94179, null, 0.06596, null, 0.74499, null, 0.46809, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24964, "SRR25557815", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L002_R1_001.fastq.gz", "fastq", 422419362.0, 5707444.0, "GSM7688781 r2", "0:74.01", "A:112476977;C:98366185;G:101046586;T:110369882;N:159732", 74, null, null, null, 112476977, 98366185, 101046586, 110369882, 159732, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94275, null, 0.06539, null, 0.74523, null, 0.47247, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24965, "SRR25557816", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L003_R1_001.fastq.gz", "fastq", 424260551.0, 5733133.0, "GSM7688781 r3", "0:74.00", "A:112957538;C:98789480;G:101496747;T:110850186;N:166600", 74, null, null, null, 112957538, 98789480, 101496747, 110850186, 166600, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94174, null, 0.06482, null, 0.74304, null, 0.46935, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24966, "SRR25557817", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters before trimming bases from the 5\u2019 end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 \u00b5l sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L004_R1_001.fastq.gz", "fastq", 417875320.0, 5646817.0, "GSM7688781 r4", "0:74.00", "A:111226895;C:97273168;G:100030641;T:109182520;N:162096", 74, null, null, null, 111226895, 97273168, 100030641, 109182520, 162096, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94352, null, 0.06524, null, 0.74442, null, 0.47095, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [31773, "SRR28590145", "SRX24189497", "SRS20963520", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "WT shield PGCs RNA rep2", "GSM8193374", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing", "WT shield PGCs RNA rep2", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 214 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type", "GSM8193374", "GSM8193374: WT shield PGCs RNA rep2; Danio rerio; RNA Seq", "GSM8193374 r1", "GSM8193374", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "WT_shield_PGCs_RNA_rep2_r1.fq.gz WT_shield_PGCs_RNA_rep2_r2.fq.gz", "fastq fastq", 1476298800.0, 4920996.0, "GSM8193374 r1", "0:150 1:150", "A:364072227;C:345274481;G:387289011;T:379660776;N:2305", 150, 150, null, null, 364072227, 345274481, 387289011, 379660776, 2305, "SRX24189497", "SRS20963520", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.9277, 0.92845, 0.26727, 0.2672, 0.86803, 0.86969, 0.75933, 0.75985, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31774, "SRR28590146", "SRX24189496", "SRS20963519", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "WT shield PGCs RNA rep1", "GSM8193373", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing", "WT shield PGCs RNA rep1", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 212 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type", "GSM8193373", "GSM8193373: WT shield PGCs RNA rep1; Danio rerio; RNA Seq", "GSM8193373 r1", "GSM8193373", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "WT_shield_PGCs_RNA_rep1_r2.fq.gz WT_shield_PGCs_RNA_rep1_r1.fq.gz", "fastq fastq", 2758778100.0, 9195927.0, "GSM8193373 r1", "0:150 1:150", "A:769058521;C:582931819;G:614181069;T:792602904;N:3787", 150, 150, null, null, 769058521, 582931819, 614181069, 792602904, 3787, "SRX24189496", "SRS20963519", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.93691, 0.91581, 0.06844, 0.06665, 0.7683, 0.76995, 0.53645, 0.52363, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31775, "SRR28590147", "SRX24189495", "SRS20963518", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "WT bud PGCs RNA rep2", "GSM8193372", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing", "WT bud PGCs RNA rep2", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 210 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type", "GSM8193372", "GSM8193372: WT bud PGCs RNA rep2; Danio rerio; RNA Seq", "GSM8193372 r1", "GSM8193372", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "WT_bud_PGCs_RNA_rep2_r1.fq.gz WT_bud_PGCs_RNA_rep2_r2.fq.gz", "fastq fastq", 3111261300.0, 10370871.0, "GSM8193372 r1", "0:150 1:150", "A:817262319;C:691724200;G:751270343;T:850999265;N:5173", 150, 150, null, null, 817262319, 691724200, 751270343, 850999265, 5173, "SRX24189495", "SRS20963518", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.90729, 0.9053, 0.11596, 0.1166, 0.79963, 0.79981, 0.60276, 0.59912, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31776, "SRR28590148", "SRX24189494", "SRS20963517", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "WT bud PGCs RNA rep1", "GSM8193371", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing", "WT bud PGCs RNA rep1", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 208 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type", "GSM8193371", "GSM8193371: WT bud PGCs RNA rep1; Danio rerio; RNA Seq", "GSM8193371 r1", "GSM8193371", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "WT_bud_PGCs_RNA_rep1_r1.fq.gz WT_bud_PGCs_RNA_rep1_r2.fq.gz", "fastq fastq", 3758269200.0, 12527564.0, "GSM8193371 r1", "0:150 1:150", "A:1041649283;C:801966468;G:845188264;T:1069459832;N:5353", 150, 150, null, null, 1041649283, 801966468, 845188264, 1069459832, 5353, "SRX24189494", "SRS20963517", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.93714, 0.91161, 0.07974, 0.07673, 0.75785, 0.76037, 0.52906, 0.52822, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31777, "SRR28590149", "SRX24189493", "SRS20963516", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "pigu homo shield PGCs RNA rep2", "GSM8193370", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing", "pigu homo shield PGCs RNA rep2", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 206 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo", "GSM8193370", "GSM8193370: pigu homo shield PGCs RNA rep2; Danio rerio; RNA Seq", "GSM8193370 r1", "GSM8193370", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "pigu_homo_shield_PGCs_RNA_rep2_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep2_r1.fq.gz", "fastq fastq", 875630700.0, 2918769.0, "GSM8193370 r1", "0:150 1:150", "A:229625544;C:190227589;G:217096984;T:238679075;N:1508", 150, 150, null, null, 229625544, 190227589, 217096984, 238679075, 1508, "SRX24189493", "SRS20963516", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.81852, 0.81643, 0.19346, 0.19329, 0.89852, 0.89897, 0.83525, 0.83082, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31778, "SRR28590150", "SRX24189492", "SRS20963515", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "pigu homo shield PGCs RNA rep1", "GSM8193369", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing", "pigu homo shield PGCs RNA rep1", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 204 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo", "GSM8193369", "GSM8193369: pigu homo shield PGCs RNA rep1; Danio rerio; RNA Seq", "GSM8193369 r1", "GSM8193369", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "pigu_homo_shield_PGCs_RNA_rep1_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep1_r1.fq.gz", "fastq fastq", 2204383800.0, 7347946.0, "GSM8193369 r1", "0:150 1:150", "A:618947181;C:459789570;G:491705141;T:633938869;N:3039", 150, 150, null, null, 618947181, 459789570, 491705141, 633938869, 3039, "SRX24189492", "SRS20963515", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.91971, 0.9203, 0.0732, 0.07256, 0.77512, 0.77516, 0.53347, 0.53419, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31779, "SRR28590151", "SRX24189491", "SRS20963514", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "pigu homo bud PGCs RNA rep2", "GSM8193368", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing", "pigu homo bud PGCs RNA rep2", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 202 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo", "GSM8193368", "GSM8193368: pigu homo bud PGCs RNA rep2; Danio rerio; RNA Seq", "GSM8193368 r1", "GSM8193368", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "pigu_homo_bud_PGCs_RNA_rep2_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep2_r2.fq.gz", "fastq fastq", 2137638000.0, 7125460.0, "GSM8193368 r1", "0:150 1:150", "A:588045273;C:460739300;G:496293927;T:592556088;N:3412", 150, 150, null, null, 588045273, 460739300, 496293927, 592556088, 3412, "SRX24189491", "SRS20963514", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.36533, 0.36278, 0.05703, 0.057, 0.87754, 0.87811, 0.60206, 0.59677, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [31780, "SRR28590152", "SRX24189490", "SRS20963513", "SRP500320", "PRJNA1097627", "GPI transamidase complex is required for primordial germ cell migration and development in zebrafish", "GSE263481", "Transcriptome Analysis", "Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.", null, "pubmed:39741393", null, "pigu homo bud PGCs RNA rep1", "GSM8193367", null, "source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing", "pigu homo bud PGCs RNA rep1", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples", "embryo", "GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3\u2019UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 \u00b5l PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 \u00b5l and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 \u00b5l tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer\u2019s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", "The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3\u2019UTR citation was described before. Unless stated all embryos were raised in Holtfreter\u2019s solution at 28.5\u00b0C and staged as described previously.", "tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo", "GSM8193367", "GSM8193367: pigu homo bud PGCs RNA rep1; Danio rerio; RNA Seq", "GSM8193367 r1", "GSM8193367", "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 \u03bcg was DNase I Fermentas EN0521 treated at 37\u00b0C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP500320", null, null, "pigu_homo_bud_PGCs_RNA_rep1_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep1_r2.fq.gz", "fastq fastq", 2734187100.0, 9113957.0, "GSM8193367 r1", "0:150 1:150", "A:729072634;C:614811431;G:644751435;T:745548063;N:3537", 150, 150, null, null, 729072634, 614811431, 644751435, 745548063, 3537, "SRX24189490", "SRS20963513", "SRA1842063", "Tsinghua University", "Tsinghua University", 2, 0.94018, 0.93763, 0.11685, 0.1143, 0.77749, 0.78204, 0.50988, 0.50832, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "unknown", "sc", "single_cell_plate", "smartseq", null, "China", "2024-04-08", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35474, "SRR32818793", "SRX28102226", "SRS24458273", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4", "GSM8863184", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf", "GSM8863184", "GSM8863184: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq", "GSM8863184 r1", "GSM8863184", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p48-4-READ1-Sequences.txt p48-4-READ2-Sequences.txt", "fastq fastq", 6624217400.0, 33121087.0, "GSM8863184 r1", "0:100 1:100", "A:1723006485;C:1604147349;G:1556891221;T:1739763662;N:408683", 100, 100, null, null, 1723006485, 1604147349, 1556891221, 1739763662, 408683, "SRX28102226", "SRS24458273", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35475, "SRR32818794", "SRX28102225", "SRS24458272", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3", "GSM8863183", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf", "GSM8863183", "GSM8863183: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq", "GSM8863183 r1", "GSM8863183", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p48-3-READ1-Sequences.txt p48-3-READ2-Sequences.txt", "fastq fastq", 5127128400.0, 25635642.0, "GSM8863183 r1", "0:100 1:100", "A:1321647066;C:1250868808;G:1210591826;T:1343703952;N:316748", 100, 100, null, null, 1321647066, 1250868808, 1210591826, 1343703952, 316748, "SRX28102225", "SRS24458272", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35476, "SRR32818795", "SRX28102224", "SRS24458271", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2", "GSM8863182", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf", "GSM8863182", "GSM8863182: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq", "GSM8863182 r1", "GSM8863182", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p48-2-READ1-Sequences.txt p48-2-READ2-Sequences.txt", "fastq fastq", 6832644200.0, 34163221.0, "GSM8863182 r1", "0:100 1:100", "A:1762283242;C:1668293067;G:1612470421;T:1789177247;N:420223", 100, 100, null, null, 1762283242, 1668293067, 1612470421, 1789177247, 420223, "SRX28102224", "SRS24458271", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35477, "SRR32818796", "SRX28102223", "SRS24458270", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1", "GSM8863181", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf", "GSM8863181", "GSM8863181: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq", "GSM8863181 r1", "GSM8863181", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p48-1-READ1-Sequences.txt p48-1-READ2-Sequences.txt", "fastq fastq", 6861200200.0, 34306001.0, "GSM8863181 r1", "0:100 1:100", "A:1765390165;C:1682522416;G:1623224185;T:1789639564;N:423870", 100, 100, null, null, 1765390165, 1682522416, 1623224185, 1789639564, 423870, "SRX28102223", "SRS24458270", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35478, "SRR32818797", "SRX28102222", "SRS24458269", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7", "GSM8863180", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863180", "GSM8863180: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7; Danio rerio; RNA Seq", "GSM8863180 r1", "GSM8863180", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-7-READ1-Sequences.txt p36-7-READ2-Sequences.txt", "fastq fastq", 5620392000.0, 28101960.0, "GSM8863180 r1", "0:100 1:100", "A:1445709762;C:1377367138;G:1310017425;T:1486952834;N:344841", 100, 100, null, null, 1445709762, 1377367138, 1310017425, 1486952834, 344841, "SRX28102222", "SRS24458269", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35479, "SRR32818798", "SRX28102221", "SRS24458268", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6", "GSM8863179", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863179", "GSM8863179: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq", "GSM8863179 r1", "GSM8863179", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-6-READ1-Sequences.txt p36-6-READ2-Sequences.txt", "fastq fastq", 7568489000.0, 37842445.0, "GSM8863179 r1", "0:100 1:100", "A:1969395695;C:1827574975;G:1754405241;T:2016644374;N:468715", 100, 100, null, null, 1969395695, 1827574975, 1754405241, 2016644374, 468715, "SRX28102221", "SRS24458268", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35480, "SRR32818799", "SRX28102220", "SRS24458267", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5", "GSM8863178", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863178", "GSM8863178: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq", "GSM8863178 r1", "GSM8863178", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-5-READ1-Sequences.txt p36-5-READ2-Sequences.txt", "fastq fastq", 6657832800.0, 33289164.0, "GSM8863178 r1", "0:100 1:100", "A:1726677355;C:1613449895;G:1548951675;T:1768343661;N:410214", 100, 100, null, null, 1726677355, 1613449895, 1548951675, 1768343661, 410214, "SRX28102220", "SRS24458267", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35481, "SRR32818800", "SRX28102219", "SRS24458266", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4", "GSM8863177", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863177", "GSM8863177: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq", "GSM8863177 r1", "GSM8863177", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-4-READ1-Sequences.txt p36-4-READ2-Sequences.txt", "fastq fastq", 5153263800.0, 25766319.0, "GSM8863177 r1", "0:100 1:100", "A:1334474056;C:1251026482;G:1191417010;T:1376027996;N:318256", 100, 100, null, null, 1334474056, 1251026482, 1191417010, 1376027996, 318256, "SRX28102219", "SRS24458266", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35482, "SRR32818801", "SRX28102218", "SRS24458265", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3", "GSM8863176", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863176", "GSM8863176: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq", "GSM8863176 r1", "GSM8863176", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-3-READ1-Sequences.txt p36-3-READ2-Sequences.txt", "fastq fastq", 6089823000.0, 30449115.0, "GSM8863176 r1", "0:100 1:100", "A:1565216204;C:1493655703;G:1438012972;T:1592561753;N:376368", 100, 100, null, null, 1565216204, 1493655703, 1438012972, 1592561753, 376368, "SRX28102218", "SRS24458265", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35483, "SRR32818802", "SRX28102217", "SRS24458264", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2", "GSM8863175", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863175", "GSM8863175: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq", "GSM8863175 r1", "GSM8863175", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-2-READ1-Sequences.txt p36-2-READ2-Sequences.txt", "fastq fastq", 5575798600.0, 27878993.0, "GSM8863175 r1", "0:100 1:100", "A:1443367045;C:1355595610;G:1298738880;T:1477753374;N:343691", 100, 100, null, null, 1443367045, 1355595610, 1298738880, 1477753374, 343691, "SRX28102217", "SRS24458264", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [35484, "SRR32818803", "SRX28102216", "SRS24458263", "SRP572438", "PRJNA1240805", "Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset", "GSE292682", "Transcriptome Analysis", "Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.", null, "pubmed:40145570", null, "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1", "GSM8863174", null, "source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing", "sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1", "Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples", "FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos", null, "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf", "GSM8863174", "GSM8863174: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq", "GSM8863174 r1", "GSM8863174", "1", "36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP572438", null, null, "p36-1-READ1-Sequences.txt p36-1-READ2-Sequences.txt", "fastq fastq", 6686065200.0, 33430326.0, "GSM8863174 r1", "0:100 1:100", "A:1705825267;C:1656952667;G:1564381164;T:1758493189;N:412913", 100, 100, null, null, 1705825267, 1656952667, 1564381164, 1758493189, 412913, "SRX28102216", "SRS24458263", "SRA2098458", "UC Irvine", "UC Irvine", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "United States", "2025-03-23", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38457, "SRR1873001", "SRX914893", "SRS869409", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S366", "GSM1629126", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S366", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629126", "GSM1629126: zf3 dis S366; Danio rerio; RNA Seq", "GSM1629126", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629126", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S366.R2.fq zf3_dis_S366.R1.fq", "fastq fastq", 13953150.0, 279063.0, "GSM1629126 r1", "0:25 1:25", "A:3638478;C:3221565;G:3250022;T:3754586;N:88499", 25, 25, null, null, 3638478, 3221565, 3250022, 3754586, 88499, "SRX914893", "SRS869409", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.68547, 0.72347, 0.17435, 0.1776, 0.89883, 0.87645, 0.78642, 0.70697, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38458, "SRR1873000", "SRX914892", "SRS869415", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S365", "GSM1629125", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S365", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629125", "GSM1629125: zf3 dis S365; Danio rerio; RNA Seq", "GSM1629125", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629125", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S365.R1.fq zf3_dis_S365.R2.fq", "fastq fastq", 18319750.0, 366395.0, "GSM1629125 r1", "0:25 1:25", "A:4713431;C:4306960;G:4405843;T:4784636;N:108880", 25, 25, null, null, 4713431, 4306960, 4405843, 4784636, 108880, "SRX914892", "SRS869415", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.45031, 0.41097, 0.17574, 0.16675, 0.91098, 0.92383, 0.57619, 0.61898, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38459, "SRR1872999", "SRX914891", "SRS869411", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S364", "GSM1629124", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S364", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629124", "GSM1629124: zf3 dis S364; Danio rerio; RNA Seq", "GSM1629124", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629124", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S364.R1.fq zf3_dis_S364.R2.fq", "fastq fastq", 16291400.0, 325828.0, "GSM1629124 r1", "0:25 1:25", "A:4127905;C:3884549;G:3934831;T:4281925;N:62190", 25, 25, null, null, 4127905, 3884549, 3934831, 4281925, 62190, "SRX914891", "SRS869411", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.64233, 0.58456, 0.18268, 0.16828, 0.89079, 0.91056, 0.69046, 0.76873, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38460, "SRR1872998", "SRX914890", "SRS869413", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S363", "GSM1629123", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S363", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629123", "GSM1629123: zf3 dis S363; Danio rerio; RNA Seq", "GSM1629123", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629123", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S363.R1.fq zf3_dis_S363.R2.fq", "fastq fastq", 24979500.0, 499590.0, "GSM1629123 r1", "0:25 1:25", "A:6522125;C:5838067;G:5906327;T:6630372;N:82609", 25, 25, null, null, 6522125, 5838067, 5906327, 6630372, 82609, "SRX914890", "SRS869413", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.78356, 0.7193, 0.35183, 0.32737, 0.85096, 0.86953, 0.65229, 0.72787, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38461, "SRR1872997", "SRX914889", "SRS869410", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S362", "GSM1629122", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S362", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629122", "GSM1629122: zf3 dis S362; Danio rerio; RNA Seq", "GSM1629122", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629122", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S362.R1.fq zf3_dis_S362.R2.fq", "fastq fastq", 25961150.0, 519223.0, "GSM1629122 r1", "0:25 1:25", "A:6513860;C:6274276;G:6330224;T:6742925;N:99865", 25, 25, null, null, 6513860, 6274276, 6330224, 6742925, 99865, "SRX914889", "SRS869410", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.64392, 0.70212, 0.20822, 0.2179, 0.90449, 0.88544, 0.7447, 0.66953, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38462, "SRR1872996", "SRX914888", "SRS869414", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S361", "GSM1629121", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S361", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629121", "GSM1629121: zf3 dis S361; Danio rerio; RNA Seq", "GSM1629121", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629121", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S361.R1.fq zf3_dis_S361.R2.fq", "fastq fastq", 31158400.0, 623168.0, "GSM1629121 r1", "0:25 1:25", "A:8003929;C:7345167;G:7419409;T:8283464;N:106431", 25, 25, null, null, 8003929, 7345167, 7419409, 8283464, 106431, "SRX914888", "SRS869414", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.69021, 0.64535, 0.18688, 0.18054, 0.86624, 0.88789, 0.69784, 0.78517, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38463, "SRR1872995", "SRX914887", "SRS869416", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S360", "GSM1629120", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S360", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629120", "GSM1629120: zf3 dis S360; Danio rerio; RNA Seq", "GSM1629120", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629120", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S360.R1.fq zf3_dis_S360.R2.fq", "fastq fastq", 65650.0, 1313.0, "GSM1629120 r1", "0:25 1:25", "A:16756;C:15635;G:13912;T:19083;N:264", 25, 25, null, null, 16756, 15635, 13912, 19083, 264, "SRX914887", "SRS869416", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.6792, 0.7566, 0.21098, 0.22718, 0.99823, 0.99667, 0.76729, 0.68093, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38464, "SRR1872994", "SRX914886", "SRS869408", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S359", "GSM1629119", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S359", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629119", "GSM1629119: zf3 dis S359; Danio rerio; RNA Seq", "GSM1629119", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629119", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S359.R1.fq zf3_dis_S359.R2.fq", "fastq fastq", 11699050.0, 233981.0, "GSM1629119 r1", "0:25 1:25", "A:3029078;C:2720012;G:2748834;T:3147149;N:53977", 25, 25, null, null, 3029078, 2720012, 2748834, 3147149, 53977, "SRX914886", "SRS869408", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.73706, 0.69089, 0.16704, 0.16123, 0.88795, 0.90696, 0.71161, 0.78714, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38465, "SRR1872993", "SRX914885", "SRS869417", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S358", "GSM1629118", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S358", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629118", "GSM1629118: zf3 dis S358; Danio rerio; RNA Seq", "GSM1629118", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629118", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S358.R2.fq zf3_dis_S358.R1.fq", "fastq fastq", 9555800.0, 191116.0, "GSM1629118 r1", "0:25 1:25", "A:2455617;C:2236174;G:2275012;T:2547459;N:41538", 25, 25, null, null, 2455617, 2236174, 2275012, 2547459, 41538, "SRX914885", "SRS869417", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.71513, 0.67049, 0.20389, 0.18909, 0.90289, 0.91758, 0.72281, 0.78587, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38466, "SRR1872992", "SRX914884", "SRS869420", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S357", "GSM1629117", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S357", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629117", "GSM1629117: zf3 dis S357; Danio rerio; RNA Seq", "GSM1629117", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629117", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S357.R1.fq zf3_dis_S357.R2.fq", "fastq fastq", 6685400.0, 133708.0, "GSM1629117 r1", "0:25 1:25", "A:1794401;C:1506998;G:1499676;T:1830754;N:53571", 25, 25, null, null, 1794401, 1506998, 1499676, 1830754, 53571, "SRX914884", "SRS869420", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.51579, 0.51107, 0.13925, 0.12582, 0.95089, 0.95828, 0.33071, 0.8304, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38467, "SRR1872991", "SRX914883", "SRS869418", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S356", "GSM1629116", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S356", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629116", "GSM1629116: zf3 dis S356; Danio rerio; RNA Seq", "GSM1629116", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629116", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S356.R2.fq zf3_dis_S356.R1.fq", "fastq fastq", 11637750.0, 232755.0, "GSM1629116 r1", "0:25 1:25", "A:2892151;C:2796777;G:2856920;T:3041989;N:49913", 25, 25, null, null, 2892151, 2796777, 2856920, 3041989, 49913, "SRX914883", "SRS869418", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.78167, 0.71632, 0.23745, 0.21955, 0.89262, 0.91054, 0.67329, 0.74109, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38468, "SRR1872990", "SRX914882", "SRS869419", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S355", "GSM1629115", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S355", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629115", "GSM1629115: zf3 dis S355; Danio rerio; RNA Seq", "GSM1629115", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629115", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S355.R2.fq zf3_dis_S355.R1.fq", "fastq fastq", 16269550.0, 325391.0, "GSM1629115 r1", "0:25 1:25", "A:4085539;C:3887330;G:3971738;T:4261948;N:62995", 25, 25, null, null, 4085539, 3887330, 3971738, 4261948, 62995, "SRX914882", "SRS869419", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.67445, 0.74201, 0.22487, 0.24114, 0.90473, 0.88637, 0.73772, 0.66677, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38469, "SRR1872989", "SRX914881", "SRS869421", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S354", "GSM1629114", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S354", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629114", "GSM1629114: zf3 dis S354; Danio rerio; RNA Seq", "GSM1629114", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629114", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S354.R1.fq zf3_dis_S354.R2.fq", "fastq fastq", 17585450.0, 351709.0, "GSM1629114 r1", "0:25 1:25", "A:4659589;C:4039300;G:4045812;T:4733042;N:107707", 25, 25, null, null, 4659589, 4039300, 4045812, 4733042, 107707, "SRX914881", "SRS869421", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.4878, 0.45754, 0.15743, 0.15052, 0.91849, 0.9321, 0.70142, 0.77697, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38470, "SRR1872988", "SRX914880", "SRS869422", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S353", "GSM1629113", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S353", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629113", "GSM1629113: zf3 dis S353; Danio rerio; RNA Seq", "GSM1629113", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629113", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S353.R2.fq zf3_dis_S353.R1.fq", "fastq fastq", 14485550.0, 289711.0, "GSM1629113 r1", "0:25 1:25", "A:3738800;C:3399635;G:3435347;T:3844352;N:67416", 25, 25, null, null, 3738800, 3399635, 3435347, 3844352, 67416, "SRX914880", "SRS869422", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.62055, 0.56082, 0.17925, 0.17361, 0.88698, 0.90761, 0.63705, 0.72713, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38471, "SRR1872987", "SRX914879", "SRS869427", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S352", "GSM1629112", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S352", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629112", "GSM1629112: zf3 dis S352; Danio rerio; RNA Seq", "GSM1629112", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629112", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S352.R1.fq zf3_dis_S352.R2.fq", "fastq fastq", 20656250.0, 413125.0, "GSM1629112 r1", "0:25 1:25", "A:5409278;C:4778324;G:4823018;T:5565607;N:80023", 25, 25, null, null, 5409278, 4778324, 4823018, 5565607, 80023, "SRX914879", "SRS869427", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.7596, 0.69086, 0.29648, 0.27453, 0.84843, 0.87265, 0.65665, 0.73501, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38472, "SRR1872986", "SRX914878", "SRS869407", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S351", "GSM1629111", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S351", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629111", "GSM1629111: zf3 dis S351; Danio rerio; RNA Seq", "GSM1629111", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629111", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S351.R2.fq zf3_dis_S351.R1.fq", "fastq fastq", 18878500.0, 377570.0, "GSM1629111 r1", "0:25 1:25", "A:4794224;C:4526355;G:4554783;T:4925799;N:77339", 25, 25, null, null, 4794224, 4526355, 4554783, 4925799, 77339, "SRX914878", "SRS869407", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.59735, 0.65152, 0.17597, 0.18275, 0.91204, 0.89367, 0.73252, 0.66132, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38473, "SRR1872985", "SRX914877", "SRS869426", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S350", "GSM1629110", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S350", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629110", "GSM1629110: zf3 dis S350; Danio rerio; RNA Seq", "GSM1629110", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629110", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S350.R2.fq zf3_dis_S350.R1.fq", "fastq fastq", 18015150.0, 360303.0, "GSM1629110 r1", "0:25 1:25", "A:4757233;C:4120910;G:4152471;T:4865140;N:119396", 25, 25, null, null, 4757233, 4120910, 4152471, 4865140, 119396, "SRX914877", "SRS869426", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.59623, 0.55628, 0.16688, 0.15933, 0.89016, 0.90946, 0.68088, 0.39729, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38474, "SRR1872984", "SRX914876", "SRS869425", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S349", "GSM1629109", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S349", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629109", "GSM1629109: zf3 dis S349; Danio rerio; RNA Seq", "GSM1629109", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629109", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S349.R1.fq zf3_dis_S349.R2.fq", "fastq fastq", 18552750.0, 371055.0, "GSM1629109 r1", "0:25 1:25", "A:4713675;C:4414123;G:4487632;T:4865002;N:72318", 25, 25, null, null, 4713675, 4414123, 4487632, 4865002, 72318, "SRX914876", "SRS869425", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.73956, 0.66864, 0.29185, 0.26915, 0.8728, 0.89185, 0.64518, 0.71455, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38475, "SRR1872983", "SRX914875", "SRS869424", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S348", "GSM1629108", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S348", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629108", "GSM1629108: zf3 dis S348; Danio rerio; RNA Seq", "GSM1629108", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629108", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S348.R1.fq zf3_dis_S348.R2.fq", "fastq fastq", 18364000.0, 367280.0, "GSM1629108 r1", "0:25 1:25", "A:4467688;C:4489708;G:4651022;T:4688256;N:67326", 25, 25, null, null, 4467688, 4489708, 4651022, 4688256, 67326, "SRX914875", "SRS869424", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.82371, 0.74488, 0.27118, 0.25268, 0.86758, 0.8886, 0.65639, 0.72281, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38476, "SRR1872982", "SRX914874", "SRS869429", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S347", "GSM1629107", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S347", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629107", "GSM1629107: zf3 dis S347; Danio rerio; RNA Seq", "GSM1629107", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629107", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S347.R1.fq zf3_dis_S347.R2.fq", "fastq fastq", 21064200.0, 421284.0, "GSM1629107 r1", "0:25 1:25", "A:5412410;C:4977004;G:4997675;T:5572725;N:104386", 25, 25, null, null, 5412410, 4977004, 4997675, 5572725, 104386, "SRX914874", "SRS869429", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.5825, 0.54487, 0.15602, 0.14912, 0.89053, 0.91094, 0.71218, 0.79095, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38477, "SRR1872981", "SRX914873", "SRS869428", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S346", "GSM1629106", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S346", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629106", "GSM1629106: zf3 dis S346; Danio rerio; RNA Seq", "GSM1629106", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629106", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S346.R1.fq zf3_dis_S346.R2.fq", "fastq fastq", 14579650.0, 291593.0, "GSM1629106 r1", "0:25 1:25", "A:3652547;C:3477071;G:3552653;T:3844470;N:52909", 25, 25, null, null, 3652547, 3477071, 3552653, 3844470, 52909, "SRX914873", "SRS869428", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.84569, 0.77715, 0.24465, 0.23283, 0.87651, 0.89706, 0.69586, 0.77338, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38478, "SRR1872980", "SRX914872", "SRS869430", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S345", "GSM1629105", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S345", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629105", "GSM1629105: zf3 dis S345; Danio rerio; RNA Seq", "GSM1629105", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629105", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S345.R1.fq zf3_dis_S345.R2.fq", "fastq fastq", 19894100.0, 397882.0, "GSM1629105 r1", "0:25 1:25", "A:4978487;C:4785641;G:4877454;T:5178846;N:73672", 25, 25, null, null, 4978487, 4785641, 4877454, 5178846, 73672, "SRX914872", "SRS869430", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.80074, 0.73644, 0.28821, 0.27089, 0.87452, 0.89213, 0.68194, 0.75059, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38479, "SRR1872979", "SRX914871", "SRS869433", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S344", "GSM1629104", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S344", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629104", "GSM1629104: zf3 dis S344; Danio rerio; RNA Seq", "GSM1629104", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629104", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S344.R2.fq zf3_dis_S344.R1.fq", "fastq fastq", 21335200.0, 426704.0, "GSM1629104 r1", "0:25 1:25", "A:5277911;C:5144153;G:5264908;T:5565367;N:82861", 25, 25, null, null, 5277911, 5144153, 5264908, 5565367, 82861, "SRX914871", "SRS869433", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.72171, 0.80382, 0.21052, 0.21995, 0.89061, 0.86695, 0.72932, 0.64495, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38480, "SRR1872978", "SRX914870", "SRS869431", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S343", "GSM1629103", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S343", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629103", "GSM1629103: zf3 dis S343; Danio rerio; RNA Seq", "GSM1629103", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629103", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S343.R1.fq zf3_dis_S343.R2.fq", "fastq fastq", 19911000.0, 398220.0, "GSM1629103 r1", "0:25 1:25", "A:4923353;C:4815086;G:4933744;T:5166820;N:71997", 25, 25, null, null, 4923353, 4815086, 4933744, 5166820, 71997, "SRX914870", "SRS869431", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.79232, 0.71735, 0.23984, 0.22867, 0.88943, 0.91074, 0.64925, 0.73421, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38481, "SRR1872977", "SRX914869", "SRS869432", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1800", "GSM1629102", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1800", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629102", "GSM1629102: zf3 dis S1800; Danio rerio; RNA Seq", "GSM1629102", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629102", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1800.R1.fq zf3_dis_S1800.R2.fq", "fastq fastq", 10790700.0, 215814.0, "GSM1629102 r1", "0:25 1:25", "A:2721576;C:2556263;G:2606994;T:2865815;N:40052", 25, 25, null, null, 2721576, 2556263, 2606994, 2865815, 40052, "SRX914869", "SRS869432", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.76882, 0.8569, 0.22815, 0.24284, 0.90851, 0.88925, 0.73921, 0.67204, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38482, "SRR1872976", "SRX914868", "SRS869434", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1799", "GSM1629101", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1799", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629101", "GSM1629101: zf3 dis S1799; Danio rerio; RNA Seq", "GSM1629101", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629101", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1799.R1.fq zf3_dis_S1799.R2.fq", "fastq fastq", 5593150.0, 111863.0, "GSM1629101 r1", "0:25 1:25", "A:1395285;C:1345325;G:1376091;T:1455988;N:20461", 25, 25, null, null, 1395285, 1345325, 1376091, 1455988, 20461, "SRX914868", "SRS869434", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.85141, 0.7543, 0.26701, 0.24608, 0.91443, 0.93028, 0.65519, 0.7383, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38483, "SRR1872975", "SRX914867", "SRS869435", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1798", "GSM1629100", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1798", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629100", "GSM1629100: zf3 dis S1798; Danio rerio; RNA Seq", "GSM1629100", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629100", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1798.R2.fq zf3_dis_S1798.R1.fq", "fastq fastq", 10414350.0, 208287.0, "GSM1629100 r1", "0:25 1:25", "A:2580685;C:2509293;G:2567981;T:2715865;N:40526", 25, 25, null, null, 2580685, 2509293, 2567981, 2715865, 40526, "SRX914867", "SRS869435", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.86357, 0.77003, 0.26639, 0.24899, 0.88876, 0.90916, 0.65432, 0.73207, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38484, "SRR1872974", "SRX914866", "SRS869436", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1797", "GSM1629099", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1797", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629099", "GSM1629099: zf3 dis S1797; Danio rerio; RNA Seq", "GSM1629099", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629099", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1797.R1.fq zf3_dis_S1797.R2.fq", "fastq fastq", 15301850.0, 306037.0, "GSM1629099 r1", "0:25 1:25", "A:3854776;C:3654525;G:3713786;T:4018813;N:59950", 25, 25, null, null, 3854776, 3654525, 3713786, 4018813, 59950, "SRX914866", "SRS869436", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.854, 0.76358, 0.30542, 0.28721, 0.87448, 0.89392, 0.62852, 0.70188, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38485, "SRR1872973", "SRX914865", "SRS869437", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1796", "GSM1629098", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1796", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629098", "GSM1629098: zf3 dis S1796; Danio rerio; RNA Seq", "GSM1629098", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629098", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1796.R2.fq zf3_dis_S1796.R1.fq", "fastq fastq", 8775100.0, 175502.0, "GSM1629098 r1", "0:25 1:25", "A:2202984;C:2111992;G:2131355;T:2296008;N:32761", 25, 25, null, null, 2202984, 2111992, 2131355, 2296008, 32761, "SRX914865", "SRS869437", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.73886, 0.82202, 0.24645, 0.25948, 0.89069, 0.87282, 0.71893, 0.66123, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38486, "SRR1872972", "SRX914864", "SRS869438", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1795", "GSM1629097", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1795", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629097", "GSM1629097: zf3 dis S1795; Danio rerio; RNA Seq", "GSM1629097", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629097", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1795.R1.fq zf3_dis_S1795.R2.fq", "fastq fastq", 3867650.0, 77353.0, "GSM1629097 r1", "0:25 1:25", "A:945418;C:947115;G:963293;T:998039;N:13785", 25, 25, null, null, 945418, 947115, 963293, 998039, 13785, "SRX914864", "SRS869438", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.84833, 0.75285, 0.27938, 0.26663, 0.91543, 0.93026, 0.63501, 0.69265, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38487, "SRR1872971", "SRX914863", "SRS869406", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1794", "GSM1629096", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1794", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629096", "GSM1629096: zf3 dis S1794; Danio rerio; RNA Seq", "GSM1629096", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629096", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1794.R1.fq zf3_dis_S1794.R2.fq", "fastq fastq", 8452150.0, 169043.0, "GSM1629096 r1", "0:25 1:25", "A:2071197;C:2071760;G:2110479;T:2169192;N:29522", 25, 25, null, null, 2071197, 2071760, 2110479, 2169192, 29522, "SRX914863", "SRS869406", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.73958, 0.83971, 0.24128, 0.26353, 0.91887, 0.90023, 0.72096, 0.64372, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38488, "SRR1872970", "SRX914862", "SRS869439", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1793", "GSM1629095", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1793", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629095", "GSM1629095: zf3 dis S1793; Danio rerio; RNA Seq", "GSM1629095", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629095", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1793.R1.fq zf3_dis_S1793.R2.fq", "fastq fastq", 8832450.0, 176649.0, "GSM1629095 r1", "0:25 1:25", "A:2188095;C:2142691;G:2187563;T:2283127;N:30974", 25, 25, null, null, 2188095, 2142691, 2187563, 2283127, 30974, "SRX914862", "SRS869439", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.82613, 0.72679, 0.22978, 0.21996, 0.89323, 0.91263, 0.60951, 0.69076, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38489, "SRR1872969", "SRX914861", "SRS869405", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1792", "GSM1629094", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1792", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629094", "GSM1629094: zf3 dis S1792; Danio rerio; RNA Seq", "GSM1629094", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629094", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1792.R1.fq zf3_dis_S1792.R2.fq", "fastq fastq", 5363400.0, 107268.0, "GSM1629094 r1", "0:25 1:25", "A:1333155;C:1295485;G:1314864;T:1400923;N:18973", 25, 25, null, null, 1333155, 1295485, 1314864, 1400923, 18973, "SRX914861", "SRS869405", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.79882, 0.71843, 0.19651, 0.18206, 0.91967, 0.93679, 0.67635, 0.75194, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38490, "SRR1872968", "SRX914860", "SRS869440", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1791", "GSM1629093", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1791", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629093", "GSM1629093: zf3 dis S1791; Danio rerio; RNA Seq", "GSM1629093", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629093", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1791.R1.fq zf3_dis_S1791.R2.fq", "fastq fastq", 6287000.0, 125740.0, "GSM1629093 r1", "0:25 1:25", "A:1573148;C:1505013;G:1531762;T:1654056;N:23021", 25, 25, null, null, 1573148, 1505013, 1531762, 1654056, 23021, "SRX914860", "SRS869440", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.7364, 0.83315, 0.21321, 0.23072, 0.92579, 0.90887, 0.74029, 0.65374, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38491, "SRR1872967", "SRX914859", "SRS869441", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1790", "GSM1629092", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1790", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629092", "GSM1629092: zf3 dis S1790; Danio rerio; RNA Seq", "GSM1629092", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629092", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1790.R1.fq zf3_dis_S1790.R2.fq", "fastq fastq", 10112150.0, 202243.0, "GSM1629092 r1", "0:25 1:25", "A:2508260;C:2430588;G:2481266;T:2652826;N:39210", 25, 25, null, null, 2508260, 2430588, 2481266, 2652826, 39210, "SRX914859", "SRS869441", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.76794, 0.86354, 0.24185, 0.25375, 0.90084, 0.87858, 0.7102, 0.64235, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38492, "SRR1872966", "SRX914858", "SRS869402", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1789", "GSM1629091", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1789", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629091", "GSM1629091: zf3 dis S1789; Danio rerio; RNA Seq", "GSM1629091", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629091", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1789.R1.fq zf3_dis_S1789.R2.fq", "fastq fastq", 11231050.0, 224621.0, "GSM1629091 r1", "0:25 1:25", "A:2804694;C:2700654;G:2738351;T:2946403;N:40948", 25, 25, null, null, 2804694, 2700654, 2738351, 2946403, 40948, "SRX914858", "SRS869402", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.77491, 0.865, 0.23972, 0.24944, 0.90173, 0.88138, 0.73586, 0.39217, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38493, "SRR1872965", "SRX914857", "SRS869401", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1788", "GSM1629090", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1788", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629090", "GSM1629090: zf3 dis S1788; Danio rerio; RNA Seq", "GSM1629090", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629090", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1788.R1.fq zf3_dis_S1788.R2.fq", "fastq fastq", 10314050.0, 206281.0, "GSM1629090 r1", "0:25 1:25", "A:2552958;C:2507831;G:2553958;T:2660287;N:39016", 25, 25, null, null, 2552958, 2507831, 2553958, 2660287, 39016, "SRX914857", "SRS869401", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.75288, 0.84683, 0.24666, 0.25857, 0.9178, 0.89785, 0.70009, 0.64569, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38494, "SRR1872964", "SRX914856", "SRS869404", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1787", "GSM1629089", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1787", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629089", "GSM1629089: zf3 dis S1787; Danio rerio; RNA Seq", "GSM1629089", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629089", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1787.R1.fq zf3_dis_S1787.R2.fq", "fastq fastq", 10036550.0, 200731.0, "GSM1629089 r1", "0:25 1:25", "A:2476382;C:2435406;G:2478877;T:2611435;N:34450", 25, 25, null, null, 2476382, 2435406, 2478877, 2611435, 34450, "SRX914856", "SRS869404", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.76416, 0.85721, 0.24235, 0.25133, 0.91019, 0.89085, 0.72942, 0.65077, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38495, "SRR1872963", "SRX914855", "SRS869403", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1786", "GSM1629088", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1786", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629088", "GSM1629088: zf3 dis S1786; Danio rerio; RNA Seq", "GSM1629088", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629088", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1786.R1.fq zf3_dis_S1786.R2.fq", "fastq fastq", 10707900.0, 214158.0, "GSM1629088 r1", "0:25 1:25", "A:2626362;C:2606657;G:2669488;T:2766478;N:38915", 25, 25, null, null, 2626362, 2606657, 2669488, 2766478, 38915, "SRX914855", "SRS869403", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.76097, 0.85966, 0.23352, 0.2479, 0.91352, 0.89244, 0.70793, 0.63433, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38496, "SRR1872962", "SRX914854", "SRS869400", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1785", "GSM1629087", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1785", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629087", "GSM1629087: zf3 dis S1785; Danio rerio; RNA Seq", "GSM1629087", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629087", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1785.R1.fq zf3_dis_S1785.R2.fq", "fastq fastq", 13552600.0, 271052.0, "GSM1629087 r1", "0:25 1:25", "A:3331733;C:3298975;G:3371183;T:3504256;N:46453", 25, 25, null, null, 3331733, 3298975, 3371183, 3504256, 46453, "SRX914854", "SRS869400", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.8397, 0.74277, 0.22428, 0.21707, 0.88653, 0.90569, 0.6195, 0.69908, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [38497, "SRR1872961", "SRX914853", "SRS869443", "SRP055996", "PRJNA277737", "Spatial reconstruction of single cell gene expression", "GSE66688", "Transcriptome Analysis", "Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat\u2019s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly", null, "pubmed:25867923", null, "zf3 dis S1784", "GSM1629086", null, "tissue:50% Epiboly stage|group:experimental batch 3", "zf3 dis S1784", "To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5\u2019 end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples", "50% Epiboly stage", null, "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4\u20135 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23\u00b0C or 28\u00b0C until they reached 50% epiboly about 6 hpf at 28\u00b0C. At 50% epiboly single embryos were visually confirmed to be at the correct stage", "group:experimental batch 3", "GSM1629086", "GSM1629086: zf3 dis S1784; Danio rerio; RNA Seq", "GSM1629086", null, "1", "Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 \u03bcl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 \u03bcl of DMEM/F12 was added to dilute the cell mixture then 120 \u03bcl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 \u03bcl of media that contained a single cell. This was pipetted into 3 \u03bcl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5\u2019 transcript end retains strand information and is compatible with standard Illumina sequencing primers.", "GEO Accession:GSM1629086", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP055996", null, "loader:fastq load.py", "zf3_dis_S1784.R1.fq zf3_dis_S1784.R2.fq", "fastq fastq", 4404200.0, 88084.0, "GSM1629086 r1", "0:25 1:25", "A:1084888;C:1067528;G:1088523;T:1145020;N:18241", 25, 25, null, null, 1084888, 1067528, 1088523, 1145020, 18241, "SRX914853", "SRS869443", "SRA246089", "GEO", "Satija Lab, New York Genome Center", 2, 0.8337, 0.73219, 0.2522, 0.22849, 0.92415, 0.93973, 0.64174, 0.72344, 25, 25, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2015-03-09", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 1308, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"technology\" = :p1 order by rowid limit 101", "params": {"p0": "Multi-stage", "p1": "smartseq"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "cDNA", "label": "cDNA", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&experiment.library_selection=cDNA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 1261, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 47, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "Embryo", "label": "Embryo", "count": 1211, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 97, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&devstage_curation_coarse=Multi-stage", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "Multi-stage", "label": "Multi-stage", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=smartseq", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 1249, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation_coarse=All+anatomical+structures", "selected": false}, {"value": "Nervous System", "label": "Nervous System", "count": 44, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Liver and Biliary System", "label": "Liver and Biliary System", "count": 15, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation_coarse=Liver+and+Biliary+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 1240, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation=Embryo+Imprecise", "selected": false}, {"value": "Spinal Cord", "label": "Spinal Cord", "count": 40, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation=Spinal+Cord", "selected": false}, {"value": "Liver", "label": "Liver", "count": 15, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation=Liver", "selected": false}, {"value": "Whole Organism", "label": "Whole Organism", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation=Whole+Organism", "selected": false}, {"value": "Head", "label": "Head", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&tissue_curation=Head", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq", "results": [{"value": "smartseq", "label": "smartseq", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": "38497", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&technology=smartseq&_next=38497", "private": false, "allow_execute_sql": true, "query_ms": 132.88735700007237}