{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Multi-stage\" and experiment.library_selection = \"cDNA\"", "rows": [[5026, "ERR1706529", "ERX1776763", "ERS1227000", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 C9", "SAMEA4055890", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000051|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055890|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:24:00Z|INSDC status:public|Submitter Id:d7b0b9c0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7b0b9c0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#23", "17117131", "Illumina sequencing of library 17117131  constructed from sample accession ERS1227000 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence ACTGAT.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#23.cram", "cram", 743861850.0, 4959079.0, "SC RUN 20417 1#23", "0:75 1:75", "A:188550455;C:183533703;G:184197810;T:187506925;N:72957", 75, 75, null, null, 188550455, 183533703, 184197810, 187506925, 72957, "ERX1776763", "ERS1227000", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96302, 0.96531, 0.19802, 0.19492, 0.73298, 0.73312, 0.57888, 0.58087, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5027, "ERR1706528", "ERX1776762", "ERS1226979", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 C5", "SAMEA4055869", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000050|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055869|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:35Z|INSDC status:public|Submitter Id:d7a93fb0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7a93fb0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#22", "17117119", "Illumina sequencing of library 17117119  constructed from sample accession ERS1226979 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GAGTGG.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#22.cram", "cram", 1375781700.0, 9171878.0, "SC RUN 20417 1#22", "0:75 1:75", "A:332899223;C:355056529;G:356526015;T:331162157;N:137776", 75, 75, null, null, 332899223, 355056529, 356526015, 331162157, 137776, "ERX1776762", "ERS1226979", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96835, 0.97046, 0.22984, 0.22663, 0.753, 0.75491, 0.45383, 0.51122, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5028, "ERR1706527", "ERX1776761", "ERS1226967", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 C4", "SAMEA4055857", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000049|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055857|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:22Z|INSDC status:public|Submitter Id:d7a1c5a0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7a1c5a0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#21", "17117107", "Illumina sequencing of library 17117107  constructed from sample accession ERS1226967 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence CGTACG.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#21.cram", "cram", 1984245000.0, 13228300.0, "SC RUN 20417 1#21", "0:75 1:75", "A:468564557;C:523118317;G:524896332;T:467470998;N:194796", 75, 75, null, null, 468564557, 523118317, 524896332, 467470998, 194796, "ERX1776761", "ERS1226967", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.97058, 0.97302, 0.22668, 0.22361, 0.76122, 0.76319, 0.6447, 0.64941, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5029, "ERR1706526", "ERX1776760", "ERS1226955", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 C1", "SAMEA4055845", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000048|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055845|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:08Z|INSDC status:public|Submitter Id:d799d660 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d799d660 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#20", "17117095", "Illumina sequencing of library 17117095  constructed from sample accession ERS1226955 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GTTTCG.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#20.cram", "cram", 1202223750.0, 8014825.0, "SC RUN 20417 1#20", "0:75 1:75", "A:288569721;C:312339594;G:312724314;T:288471735;N:118386", 75, 75, null, null, 288569721, 312339594, 312724314, 288471735, 118386, "ERX1776760", "ERS1226955", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.9701, 0.97208, 0.23493, 0.2308, 0.75856, 0.75893, 0.51831, 0.52827, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5030, "ERR1706525", "ERX1776759", "ERS1226947", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B11", "SAMEA4055837", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000047|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055837|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:00Z|INSDC status:public|Submitter Id:d7920e30 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7920e30 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#19", "17117083", "Illumina sequencing of library 17117083  constructed from sample accession ERS1226947 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GTGGCC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#19.cram", "cram", 1177752450.0, 7851683.0, "SC RUN 20417 1#19", "0:75 1:75", "A:311936666;C:276917229;G:278564226;T:310217446;N:116883", 75, 75, null, null, 311936666, 276917229, 278564226, 310217446, 116883, "ERX1776759", "ERS1226947", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95807, 0.96101, 0.1671, 0.16592, 0.72389, 0.72521, 0.53692, 0.53083, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5031, "ERR1706524", "ERX1776758", "ERS1226939", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B10", "SAMEA4055829", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000046|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055829|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:51Z|INSDC status:public|Submitter Id:d788e670 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d788e670 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#18", "17117071", "Illumina sequencing of library 17117071  constructed from sample accession ERS1226939 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GTGAAA.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#18.cram", "cram", 1306412850.0, 8709419.0, "SC RUN 20417 1#18", "0:75 1:75", "A:348858023;C:304800763;G:306149463;T:346474389;N:130212", 75, 75, null, null, 348858023, 304800763, 306149463, 346474389, 130212, "ERX1776758", "ERS1226939", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95746, 0.9601, 0.16534, 0.1628, 0.72297, 0.72247, 0.52807, 0.52513, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5032, "ERR1706523", "ERX1776757", "ERS1226931", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B9", "SAMEA4055821", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000045|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055821|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:43Z|INSDC status:public|Submitter Id:d780d020 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d780d020 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#17", "17117059", "Illumina sequencing of library 17117059  constructed from sample accession ERS1226931 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GTCCGC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#17.cram", "cram", 943334550.0, 6288897.0, "SC RUN 20417 1#17", "0:75 1:75", "A:250576062;C:221289820;G:222449063;T:248930088;N:89517", 75, 75, null, null, 250576062, 221289820, 222449063, 248930088, 89517, "ERX1776757", "ERS1226931", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95898, 0.9615, 0.16669, 0.16433, 0.72636, 0.7262, 0.53064, 0.52544, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5033, "ERR1706522", "ERX1776756", "ERS1226910", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B6", "SAMEA4055800", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000044|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055800|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:20Z|INSDC status:public|Submitter Id:d778e0e0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d778e0e0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#16", "17117142", "Illumina sequencing of library 17117142  constructed from sample accession ERS1226910 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence CCGTCC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#16.cram", "cram", 1397786700.0, 9318578.0, "SC RUN 20417 1#16", "0:75 1:75", "A:370541493;C:328697895;G:330649047;T:367761875;N:136390", 75, 75, null, null, 370541493, 328697895, 330649047, 367761875, 136390, "ERX1776756", "ERS1226910", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95779, 0.96097, 0.15701, 0.15529, 0.72462, 0.72425, 0.53437, 0.53651, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5034, "ERR1706521", "ERX1776755", "ERS1226903", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B4", "SAMEA4055793", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000043|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055793|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:11Z|INSDC status:public|Submitter Id:d7713fc0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7713fc0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#15", "17117130", "Illumina sequencing of library 17117130  constructed from sample accession ERS1226903 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence ATGTCA.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#15.cram", "cram", 2090642550.0, 13937617.0, "SC RUN 20417 1#15", "0:75 1:75", "A:573574606;C:473115476;G:474137164;T:569607223;N:208081", 75, 75, null, null, 573574606, 473115476, 474137164, 569607223, 208081, "ERX1776755", "ERS1226903", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95314, 0.95602, 0.13917, 0.13779, 0.71605, 0.7161, 0.5009, 0.49877, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5035, "ERR1706520", "ERX1776754", "ERS1226896", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B3", "SAMEA4055786", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000042|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055786|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:03Z|INSDC status:public|Submitter Id:d7697790 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7697790 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#14", "17117118", "Illumina sequencing of library 17117118  constructed from sample accession ERS1226896 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence AGTTCC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#14.cram", "cram", 1829182200.0, 12194548.0, "SC RUN 20417 1#14", "0:75 1:75", "A:501496169;C:412501773;G:416194477;T:498811651;N:178130", 75, 75, null, null, 501496169, 412501773, 416194477, 498811651, 178130, "ERX1776754", "ERS1226896", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95118, 0.95498, 0.14818, 0.14602, 0.71431, 0.71478, 0.49278, 0.4993, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5036, "ERR1706519", "ERX1776753", "ERS1226884", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B2", "SAMEA4055774", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000041|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055774|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:21:52Z|INSDC status:public|Submitter Id:d761fd80 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d761fd80 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#13", "17117106", "Illumina sequencing of library 17117106  constructed from sample accession ERS1226884 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence AGTCAA.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#13.cram", "cram", 969474450.0, 6463163.0, "SC RUN 20417 1#13", "0:75 1:75", "A:262909712;C:222419636;G:222543360;T:261505885;N:95857", 75, 75, null, null, 262909712, 222419636, 222543360, 261505885, 95857, "ERX1776753", "ERS1226884", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95449, 0.95866, 0.15114, 0.14937, 0.71437, 0.71465, 0.51271, 0.50858, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5037, "ERR1706518", "ERX1776752", "ERS1226870", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 B1", "SAMEA4055760", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000040|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055760|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:21:36Z|INSDC status:public|Submitter Id:d75a3550 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d75a3550 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#12", "17117094", "Illumina sequencing of library 17117094  constructed from sample accession ERS1226870 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence CTTGTA.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#12.cram", "cram", 1454862600.0, 9699084.0, "SC RUN 20417 1#12", "0:75 1:75", "A:398496982;C:328471618;G:330736633;T:397014742;N:142625", 75, 75, null, null, 398496982, 328471618, 330736633, 397014742, 142625, "ERX1776752", "ERS1226870", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95557, 0.95961, 0.13233, 0.1312, 0.71441, 0.71488, 0.49023, 0.48445, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5038, "ERR1706517", "ERX1776751", "ERS1226860", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A12", "SAMEA4055750", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000039|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055750|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:21:28Z|INSDC status:public|Submitter Id:d7529430 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7529430 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#11", "17117082", "Illumina sequencing of library 17117082  constructed from sample accession ERS1226860 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GGCTAC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#11.cram", "cram", 1746393900.0, 11642626.0, "SC RUN 20417 1#11", "0:75 1:75", "A:431979433;C:441330253;G:441743262;T:431172392;N:168560", 75, 75, null, null, 431979433, 441330253, 441743262, 431172392, 168560, "ERX1776751", "ERS1226860", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96506, 0.9668, 0.22176, 0.21891, 0.74491, 0.74621, 0.60192, 0.59716, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5039, "ERR1706516", "ERX1776750", "ERS1226849", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A11", "SAMEA4055739", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000038|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055739|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:21:18Z|INSDC status:public|Submitter Id:d74a56d0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d74a56d0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#10", "17117070", "Illumina sequencing of library 17117070  constructed from sample accession ERS1226849 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence TAGCTT.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#10.cram", "cram", 1489471050.0, 9929807.0, "SC RUN 20417 1#10", "0:75 1:75", "A:370582953;C:374410965;G:374249460;T:370079632;N:148040", 75, 75, null, null, 370582953, 374410965, 374249460, 370079632, 148040, "ERX1776750", "ERS1226849", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96529, 0.96757, 0.21607, 0.21231, 0.74272, 0.7432, 0.59703, 0.6019, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5040, "ERR1706515", "ERX1776749", "ERS1226835", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A9", "SAMEA4055725", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055725|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:21:06Z|INSDC status:public|Submitter Id:d7428ea0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7428ea0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#9", "17117058", "Illumina sequencing of library 17117058  constructed from sample accession ERS1226835 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GATCAG.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#9.cram", "cram", 812740200.0, 5418268.0, "SC RUN 20417 1#9", "0:75 1:75", "A:212802181;C:193901585;G:194345487;T:211612018;N:78929", 75, 75, null, null, 212802181, 193901585, 194345487, 211612018, 78929, "ERX1776749", "ERS1226835", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95783, 0.95996, 0.17262, 0.1685, 0.72413, 0.72448, 0.53944, 0.53954, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5041, "ERR1706514", "ERX1776748", "ERS1226824", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A8", "SAMEA4055714", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000036|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055714|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:58Z|INSDC status:public|Submitter Id:d73ac670 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d73ac670 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#8", "17117141", "Illumina sequencing of library 17117141  constructed from sample accession ERS1226824 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence ACTTGA.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#8.cram", "cram", 1782401400.0, 11882676.0, "SC RUN 20417 1#8", "0:75 1:75", "A:458909593;C:432851102;G:434061292;T:456406952;N:172461", 75, 75, null, null, 458909593, 432851102, 434061292, 456406952, 172461, "ERX1776748", "ERS1226824", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96096, 0.96367, 0.18551, 0.18292, 0.73413, 0.73373, 0.56474, 0.56438, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5042, "ERR1706513", "ERX1776747", "ERS1226813", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A7", "SAMEA4055703", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000035|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055703|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:49Z|INSDC status:public|Submitter Id:d7332550 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7332550 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#7", "17117129", "Illumina sequencing of library 17117129  constructed from sample accession ERS1226813 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence CAGATC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#7.cram", "cram", 396397350.0, 2642649.0, "SC RUN 20417 1#7", "0:75 1:75", "A:103468605;C:95292253;G:94558692;T:103038245;N:39555", 75, 75, null, null, 103468605, 95292253, 94558692, 103038245, 39555, "ERX1776747", "ERS1226813", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96013, 0.96276, 0.17171, 0.16938, 0.72941, 0.73046, 0.54526, 0.54527, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Multi-stage", "Whole Organism", "All anatomical structures"], [5043, "ERR1706512", "ERX1776746", "ERS1226790", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A6", "SAMEA4055680", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000034|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055680|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:34Z|INSDC status:public|Submitter Id:d72b5d20 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d72b5d20 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#6", "17117117", "Illumina sequencing of library 17117117  constructed from sample accession ERS1226790 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence GCCAAT.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#6.cram", "cram", 652493400.0, 4349956.0, "SC RUN 20417 1#6", null, null, null, null, null, null, null, null, null, null, null, "ERX1776746", "ERS1226790", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.94432, 0.94163, 0.16831, 0.16496, 0.72912, 0.72766, 0.50382, 0.5065, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5044, "ERR1706511", "ERX1776745", "ERS1226779", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A5", "SAMEA4055669", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000033|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055669|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:26Z|INSDC status:public|Submitter Id:d7219920 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7219920 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#5", "17117105", "Illumina sequencing of library 17117105  constructed from sample accession ERS1226779 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence ACAGTG.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#5.cram", "cram", 825205650.0, 5501371.0, "SC RUN 20417 1#5", "0:75 1:75", "A:224928393;C:188238841;G:188933086;T:223024865;N:80465", 75, 75, null, null, 224928393, 188238841, 188933086, 223024865, 80465, "ERX1776745", "ERS1226779", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95709, 0.96033, 0.14048, 0.13863, 0.71887, 0.71987, 0.49099, 0.49207, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5045, "ERR1706510", "ERX1776744", "ERS1226767", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A4", "SAMEA4055657", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000032|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:16Z|INSDC status:public|Submitter Id:d71934b0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d71934b0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#4", "17117093", "Illumina sequencing of library 17117093  constructed from sample accession ERS1226767 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence TGACCA.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#4.cram", "cram", 767189250.0, 5114595.0, "SC RUN 20417 1#4", "0:75 1:75", "A:210673766;C:173125942;G:174062852;T:209253897;N:72793", 75, 75, null, null, 210673766, 173125942, 174062852, 209253897, 72793, "ERX1776744", "ERS1226767", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95581, 0.95773, 0.11947, 0.11773, 0.72103, 0.72178, 0.4674, 0.46869, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5046, "ERR1706509", "ERX1776743", "ERS1226757", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A3", "SAMEA4055647", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000031|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:08Z|INSDC status:public|Submitter Id:d7092f20 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7092f20 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#3", "17117081", "Illumina sequencing of library 17117081  constructed from sample accession ERS1226757 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence TTAGGC.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#3.cram", "cram", 776002350.0, 5173349.0, "SC RUN 20417 1#3", "0:75 1:75", "A:207553748;C:180473885;G:180618978;T:207278008;N:77731", 75, 75, null, null, 207553748, 180473885, 180618978, 207278008, 77731, "ERX1776743", "ERS1226757", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.96457, 0.96611, 0.23757, 0.23414, 0.74507, 0.74497, 0.55158, 0.55086, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5047, "ERR1706508", "ERX1776742", "ERS1226745", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A2", "SAMEA4055635", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000030|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055635|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:19:59Z|INSDC status:public|Submitter Id:d6f77be0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d6f77be0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#2", "17117069", "Illumina sequencing of library 17117069  constructed from sample accession ERS1226745 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence CGATGT.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#2.cram", "cram", 581391900.0, 3875946.0, "SC RUN 20417 1#2", "0:75 1:75", "A:156042125;C:134966129;G:135462829;T:154862718;N:58099", 75, 75, null, null, 156042125, 134966129, 135462829, 154862718, 58099, "ERX1776742", "ERS1226745", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.9582, 0.96234, 0.1297, 0.12747, 0.72863, 0.72949, 0.48838, 0.48132, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [5048, "ERR1706507", "ERX1776741", "ERS1226722", "ERP016002", "PRJEB14364", "Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos", "Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266", "Transcriptome Analysis", "RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.", "ArrayExpress:E ERAD 507", null, null, "zmp ph260 A1", "SAMEA4055612", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:Segmentation:26+somites   Pharyngula:Prim 5   ZFS:0000028   ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055612|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:19:38Z|INSDC status:public|Submitter Id:d6e3f3e0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d6e3f3e0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 20417 1#1", "17117057", "Illumina sequencing of library 17117057  constructed from sample accession ERS1226722 for study accession ERP016002.  This is part of an Illumina multiplexed sequencing run 20417 1.  This submission includes reads tagged with the sequence ATCACG.", "RNA seq dUTP eukaryotic", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP016002", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16", "20417_1#1.cram", "cram", 1233271650.0, 8221811.0, "SC RUN 20417 1#1", "0:75 1:75", "A:334336992;C:282740616;G:283953463;T:332113804;N:126775", 75, 75, null, null, 334336992, 282740616, 283953463, 332113804, 126775, "ERX1776741", "ERS1226722", "ERA740537", "European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.95579, 0.95701, 0.15941, 0.15689, 0.71758, 0.71709, 0.4967, 0.5163, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-06-28", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10649, "ERR406885", "ERX373262", "ERS391761", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "5s24", "SAMEA2299303", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299303|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.4", "batchA 24hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "5s24.fq.gz", "fastq", 584550600.0, 11691012.0, "E MTAB 2194:5s24.fq.gz", "0:50 1:0", "A:154602150;C:138134763;G:138628704;T:153175234;N:9749", 50, 0, null, null, 154602150, 138134763, 138628704, 153175234, 9749, "ERX373262", "ERS391761", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.9356, null, 0.0996, null, 0.68615, null, 0.47069, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10650, "ERR406893", "ERX373261", "ERS391760", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "5y32", "SAMEA2299302", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299302|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.5", "batchA 32hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "5y32.fq.gz", "fastq", 528892950.0, 10577859.0, "E MTAB 2194:5y32.fq.gz", "0:50 1:0", "A:140383478;C:125036983;G:124119152;T:139344643;N:8694", 50, 0, null, null, 140383478, 125036983, 124119152, 139344643, 8694, "ERX373261", "ERS391760", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93478, null, 0.10542, null, 0.68296, null, 0.4795, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10651, "ERR406898", "ERX373260", "ERS391759", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "6s24", "SAMEA2299301", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299301|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.10", "batchB 24hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "6s24.fq.gz", "fastq", 542771850.0, 10855437.0, "E MTAB 2194:6s24.fq.gz", "0:50 1:0", "A:142311943;C:129686202;G:129130172;T:141634727;N:8806", 50, 0, null, null, 142311943, 129686202, 129130172, 141634727, 8806, "ERX373260", "ERS391759", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93717, null, 0.09239, null, 0.68876, null, 0.46809, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10652, "ERR406896", "ERX373259", "ERS391758", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "13y32", "SAMEA2299300", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299300|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.18", "batchC 32hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "13y32.fq.gz", "fastq", 649898350.0, 12997967.0, "E MTAB 2194:13y32.fq.gz", "0:50 1:0", "A:169738689;C:156130165;G:155102788;T:168916174;N:10534", 50, 0, null, null, 169738689, 156130165, 155102788, 168916174, 10534, "ERX373259", "ERS391758", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93898, null, 0.08535, null, 0.68217, null, 0.47133, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10653, "ERR406899", "ERX373258", "ERS391757", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "5s32", "SAMEA2299299", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299299|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.6", "batchA 32hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "5s32.fq.gz", "fastq", 566813600.0, 11336272.0, "E MTAB 2194:5s32.fq.gz", "0:50 1:0", "A:149907366;C:134421172;G:133399280;T:149076590;N:9192", 50, 0, null, null, 149907366, 134421172, 133399280, 149076590, 9192, "ERX373258", "ERS391757", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93497, null, 0.10019, null, 0.68379, null, 0.4671, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10654, "ERR406888", "ERX373257", "ERS391756", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "5y24", "SAMEA2299298", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299298|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.3", "batchA 24hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "5y24.fq.gz", "fastq", 578936250.0, 11578725.0, "E MTAB 2194:5y24.fq.gz", "0:50 1:0", "A:154884020;C:135497257;G:135214353;T:153331273;N:9347", 50, 0, null, null, 154884020, 135497257, 135214353, 153331273, 9347, "ERX373257", "ERS391756", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.9342, null, 0.1106, null, 0.67811, null, 0.47685, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10655, "ERR406887", "ERX373256", "ERS391755", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "13s24", "SAMEA2299297", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299297|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.16", "batchC 24hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "13s24.fq.gz", "fastq", 837415050.0, 16748301.0, "E MTAB 2194:13s24.fq.gz", "0:50 1:0", "A:217172462;C:202556518;G:201365353;T:216307386;N:13331", 50, 0, null, null, 217172462, 202556518, 201365353, 216307386, 13331, "ERX373256", "ERS391755", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93888, null, 0.07561, null, 0.6899, null, 0.46646, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10656, "ERR406894", "ERX373255", "ERS391754", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "6y24", "SAMEA2299296", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299296|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.9", "batchB 24hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "6y24.fq.gz", "fastq", 569424550.0, 11388491.0, "E MTAB 2194:6y24.fq.gz", "0:50 1:0", "A:149287318;C:136121879;G:135445765;T:148560272;N:9316", 50, 0, null, null, 149287318, 136121879, 135445765, 148560272, 9316, "ERX373255", "ERS391754", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93486, null, 0.0893, null, 0.68751, null, 0.46133, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10657, "ERR406895", "ERX373254", "ERS391753", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "13s8", "SAMEA2299295", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299295|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.14", "batchC 8hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "13s8.fq.gz", "fastq", 532141500.0, 10642830.0, "E MTAB 2194:13s8.fq.gz", "0:50 1:0", "A:139773245;C:127051350;G:126773752;T:138534560;N:8593", 50, 0, null, null, 139773245, 127051350, 126773752, 138534560, 8593, "ERX373254", "ERS391753", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93506, null, 0.0742, null, 0.74748, null, 0.47765, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10658, "ERR406891", "ERX373253", "ERS391752", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "6s8", "SAMEA2299294", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299294|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.8", "batchB 8hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "6s8.fq.gz", "fastq", 477620550.0, 9552411.0, "E MTAB 2194:6s8.fq.gz", "0:50 1:0", "A:127095393;C:112660046;G:111717464;T:126139686;N:7961", 50, 0, null, null, 127095393, 112660046, 111717464, 126139686, 7961, "ERX373253", "ERS391752", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93605, null, 0.08112, null, 0.74552, null, 0.46821, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10659, "ERR406886", "ERX373252", "ERS391751", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "6y8", "SAMEA2299293", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299293|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.7", "batchB 8hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "6y8.fq.gz", "fastq", 508637450.0, 10172749.0, "E MTAB 2194:6y8.fq.gz", "0:50 1:0", "A:135377293;C:119833844;G:119447157;T:133970958;N:8198", 50, 0, null, null, 135377293, 119833844, 119447157, 133970958, 8198, "ERX373252", "ERS391751", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93203, null, 0.07833, null, 0.73744, null, 0.47586, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10660, "ERR406892", "ERX373251", "ERS391750", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "6y32", "SAMEA2299292", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299292|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:6y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.11", "batchB 32hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "6y32.fq.gz", "fastq", 568482400.0, 11369648.0, "E MTAB 2194:6y32.fq.gz", "0:50 1:0", "A:149679881;C:135411801;G:134312216;T:149069222;N:9280", 50, 0, null, null, 149679881, 135411801, 134312216, 149069222, 9280, "ERX373251", "ERS391750", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93184, null, 0.104, null, 0.68128, null, 0.47652, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10661, "ERR406897", "ERX373250", "ERS391749", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "5y8", "SAMEA2299291", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299291|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:5y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.1", "batchA 8hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "5y8.fq.gz", "fastq", 497573200.0, 9951464.0, "E MTAB 2194:5y8.fq.gz", "0:50 1:0", "A:134128000;C:115688460;G:114668036;T:133080206;N:8498", 50, 0, null, null, 134128000, 115688460, 114668036, 133080206, 8498, "ERX373250", "ERS391749", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93519, null, 0.07057, null, 0.73511, null, 0.47977, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10662, "ERR406889", "ERX373249", "ERS391748", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "13s32", "SAMEA2299290", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299290|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:13s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.19", "batchC 32hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "13s32.fq.gz", "fastq", 637724150.0, 12754483.0, "E MTAB 2194:13s32.fq.gz", "0:50 1:0", "A:165500205;C:154383334;G:152953181;T:164877160;N:10270", 50, 0, null, null, 165500205, 154383334, 152953181, 164877160, 10270, "ERX373249", "ERS391748", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93998, null, 0.08954, null, 0.68146, null, 0.4729, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10663, "ERR406890", "ERX373248", "ERS391747", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "13y24", "SAMEA2299289", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299289|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:13y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.15", "batchC 24hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "13y24.fq.gz", "fastq", 834725800.0, 16694516.0, "E MTAB 2194:13y24.fq.gz", "0:50 1:0", "A:216896952;C:201332171;G:200308143;T:216174965;N:13569", 50, 0, null, null, 216896952, 201332171, 200308143, 216174965, 13569, "ERX373248", "ERS391747", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.9358, null, 0.07569, null, 0.68757, null, 0.46994, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10664, "ERR406900", "ERX373247", "ERS391746", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "13y8", "SAMEA2299288", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299288|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:13y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.13", "batchC 8hpf YD", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "13y8.fq.gz", "fastq", 457245150.0, 9144903.0, "E MTAB 2194:13y8.fq.gz", "0:50 1:0", "A:119648940;C:109589521;G:109491446;T:118507707;N:7536", 50, 0, null, null, 119648940, 109589521, 109491446, 118507707, 7536, "ERX373247", "ERS391746", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93146, null, 0.0681, null, 0.73718, null, 0.47464, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10665, "ERR406884", "ERX373246", "ERS391745", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "6s32", "SAMEA2299287", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299287|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:6s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.12", "batchB 32hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "6s32.fq.gz", "fastq", 652353200.0, 13047064.0, "E MTAB 2194:6s32.fq.gz", "0:50 1:0", "A:170844587;C:156203331;G:155264927;T:170029850;N:10505", 50, 0, null, null, 170844587, 156203331, 155264927, 170029850, 10505, "ERX373246", "ERS391745", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93785, null, 0.09102, null, 0.68554, null, 0.46397, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [10666, "ERR406901", "ERX373245", "ERS391744", "ERP004564", "PRJEB5188", "YD embryos 8 hpf 24 hpf 32 hpf", "E-MTAB-2194", "Transcriptome Analysis", "Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity  a poorly understood mechanism that responds to environmental cues from early to late developmental stages.  In this study  we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability  we partially remove the yolk during embryogenesis. Around 5 hpf  we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8  24 hpf and 32 hpf  we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.", null, null, "Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "5s8", "SAMEA2299286", "CAS-MPG PICB", "ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299286|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:5s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "E MTAB 2194:Unique sample ID.2", "batchA 8hpf SP", "YD embryos 8 hpf 24 hpf 32 hpf", "Zebrafish embryos in HANKS embryo buffer Around 5hpf  sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2", "Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP004564", "Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf", "ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16", "5s8.fq.gz", "fastq", 359298500.0, 7185970.0, "E MTAB 2194:5s8.fq.gz", "0:50 1:0", "A:96450828;C:83805020;G:83440885;T:95595844;N:5923", 50, 0, null, null, 96450828, 83805020, 83440885, 95595844, 5923, "ERX373245", "ERS391744", "ERA280282", "CAS-MPG PICB|ArrayExpress", "CAS-MPG PICB|ArrayExpress", 1, 0.93524, null, 0.07491, null, 0.73312, null, 0.47914, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-04-01", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13299, "ERR984502", "ERX1065723", "ERS715232", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367580", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367580|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 24 sc 2286404|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 24 sc 2286404|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#24", "13741631", "Illumina sequencing of library 13741631  constructed from sample accession ERS715232 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TTCAGCTC.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#24.cram", "cram", 570705070.0, 4390039.0, "SC RUN 16164 8#24", "0:55 1:75", "A:167603013;C:88769000;G:138595187;T:175336986;N:400884", 55, 75, null, null, 167603013, 88769000, 138595187, 175336986, 400884, "ERX1065723", "ERS715232", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.18131, 0.44012, 0.12372, 0.1122, 0.96759, 0.93835, 0.63426, 0.57651, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13300, "ERR984501", "ERX1065722", "ERS715231", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367579", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367579|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 23 sc 2286403|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 23 sc 2286403|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#23", "13741630", "Illumina sequencing of library 13741630  constructed from sample accession ERS715231 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TACTAGTC.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#23.cram", "cram", 682831890.0, 5252553.0, "SC RUN 16164 8#23", "0:55 1:75", "A:201267036;C:106752351;G:152982998;T:221347859;N:481646", 55, 75, null, null, 201267036, 106752351, 152982998, 221347859, 481646, "ERX1065722", "ERS715231", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.19992, 0.5315, 0.13001, 0.13817, 0.96025, 0.92261, 0.60527, 0.55787, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13301, "ERR984500", "ERX1065721", "ERS715230", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367578", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367578|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 22 sc 2286402|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 22 sc 2286402|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#22", "13741629", "Illumina sequencing of library 13741629  constructed from sample accession ERS715230 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCAGATTC.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#22.cram", "cram", 822730220.0, 6328694.0, "SC RUN 16164 8#22", "0:55 1:75", "A:241693794;C:130571512;G:177853465;T:272028770;N:582679", 55, 75, null, null, 241693794, 130571512, 177853465, 272028770, 582679, "ERX1065721", "ERS715230", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.2212, 0.54203, 0.15635, 0.13659, 0.96159, 0.9221, 0.59031, 0.55109, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13302, "ERR984499", "ERX1065720", "ERS715229", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367577", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367577|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 21 sc 2286401|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 21 sc 2286401|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#21", "13741628", "Illumina sequencing of library 13741628  constructed from sample accession ERS715229 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TATGCCAG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#21.cram", "cram", 616663190.0, 4743563.0, "SC RUN 16164 8#21", "0:55 1:75", "A:176848806;C:99629161;G:137029831;T:202730142;N:425250", 55, 75, null, null, 176848806, 99629161, 137029831, 202730142, 425250, "ERX1065720", "ERS715229", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.21864, 0.57174, 0.1516, 0.14103, 0.95905, 0.9192, 0.55513, 0.51633, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13303, "ERR984498", "ERX1065719", "ERS715228", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367576", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367576|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 20 sc 2286400|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 20 sc 2286400|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#20", "13741627", "Illumina sequencing of library 13741627  constructed from sample accession ERS715228 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TGGCTCAG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#20.cram", "cram", 708059950.0, 5446615.0, "SC RUN 16164 8#20", "0:55 1:75", "A:195264246;C:129715499;G:160155422;T:222438911;N:485872", 55, 75, null, null, 195264246, 129715499, 160155422, 222438911, 485872, "ERX1065719", "ERS715228", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.19642, 0.48584, 0.11921, 0.11811, 0.95422, 0.91843, 0.62494, 0.56646, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13304, "ERR984497", "ERX1065718", "ERS715227", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367575", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367575|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 19 sc 2286399|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 19 sc 2286399|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#19", "13741626", "Illumina sequencing of library 13741626  constructed from sample accession ERS715227 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCATTGAG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#19.cram", "cram", 651943890.0, 5014953.0, "SC RUN 16164 8#19", "0:55 1:75", "A:191809575;C:111573276;G:144109125;T:204007845;N:444069", 55, 75, null, null, 191809575, 111573276, 144109125, 204007845, 444069, "ERX1065718", "ERS715227", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.17909, 0.44616, 0.12326, 0.12424, 0.96256, 0.93432, 0.56606, 0.52819, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13305, "ERR984496", "ERX1065717", "ERS715226", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367574", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367574|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 18 sc 2286398|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 18 sc 2286398|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#18", "13741625", "Illumina sequencing of library 13741625  constructed from sample accession ERS715226 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TGTATGCG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#18.cram", "cram", 610476620.0, 4695974.0, "SC RUN 16164 8#18", "0:55 1:75", "A:181332724;C:99472616;G:132687929;T:196571397;N:411954", 55, 75, null, null, 181332724, 99472616, 132687929, 196571397, 411954, "ERX1065717", "ERS715226", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.22636, 0.55559, 0.16123, 0.16819, 0.96025, 0.92967, 0.59576, 0.54685, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13306, "ERR984495", "ERX1065716", "ERS715225", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367573", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367573|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 17 sc 2286397|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 17 sc 2286397|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#17", "13741624", "Illumina sequencing of library 13741624  constructed from sample accession ERS715225 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCCAGTCG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#17.cram", "cram", 712320830.0, 5479391.0, "SC RUN 16164 8#17", "0:55 1:75", "A:204316194;C:115198795;G:158608369;T:233717227;N:480245", 55, 75, null, null, 204316194, 115198795, 158608369, 233717227, 480245, "ERX1065716", "ERS715225", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.2492, 0.59739, 0.17155, 0.14862, 0.95657, 0.92056, 0.58039, 0.53475, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13307, "ERR984494", "ERX1065715", "ERS715224", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367572", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367572|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 16 sc 2286396|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 16 sc 2286396|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#16", "13741623", "Illumina sequencing of library 13741623  constructed from sample accession ERS715224 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TAAGTTCG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#16.cram", "cram", 793769340.0, 6105918.0, "SC RUN 16164 8#16", "0:55 1:75", "A:232264866;C:130235228;G:171709756;T:259013732;N:545758", 55, 75, null, null, 232264866, 130235228, 171709756, 259013732, 545758, "ERX1065715", "ERS715224", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.22065, 0.5061, 0.15274, 0.13242, 0.95779, 0.92575, 0.57619, 0.53869, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13308, "ERR984493", "ERX1065714", "ERS715223", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367571", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367571|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 15 sc 2286395|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 15 sc 2286395|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#15", "13741622", "Illumina sequencing of library 13741622  constructed from sample accession ERS715223 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCAGGAGG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#15.cram", "cram", 785479760.0, 6042152.0, "SC RUN 16164 8#15", "0:55 1:75", "A:221631721;C:150326010;G:172964474;T:240036379;N:521176", 55, 75, null, null, 221631721, 150326010, 172964474, 240036379, 521176, "ERX1065714", "ERS715223", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.26761, 0.37751, 0.19858, 0.09301, 0.95162, 0.93129, 0.56282, 0.54289, 55, 75, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13309, "ERR984492", "ERX1065713", "ERS715222", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367570", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367570|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 14 sc 2286394|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 14 sc 2286394|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#14", "13741621", "Illumina sequencing of library 13741621  constructed from sample accession ERS715222 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCTCACGG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#14.cram", "cram", 673293530.0, 5179181.0, "SC RUN 16164 8#14", "0:55 1:75", "A:188203068;C:115934699;G:155324541;T:213374769;N:456453", 55, 75, null, null, 188203068, 115934699, 155324541, 213374769, 456453, "ERX1065713", "ERS715222", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.21855, 0.57586, 0.15197, 0.14501, 0.95946, 0.93077, 0.56453, 0.52351, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13310, "ERR984491", "ERX1065712", "ERS715221", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367569", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367569|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 13 sc 2286393|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 13 sc 2286393|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#13", "13741620", "Illumina sequencing of library 13741620  constructed from sample accession ERS715221 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TACTTCGG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#13.cram", "cram", 783634020.0, 6027954.0, "SC RUN 16164 8#13", "0:55 1:75", "A:231435775;C:129417634;G:178939153;T:243302897;N:538561", 55, 75, null, null, 231435775, 129417634, 178939153, 243302897, 538561, "ERX1065712", "ERS715221", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.20287, 0.52947, 0.14655, 0.13479, 0.96299, 0.93703, 0.56376, 0.52626, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13311, "ERR984490", "ERX1065711", "ERS715220", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367568", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367568|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 12 sc 2286392|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 12 sc 2286392|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#12", "13741619", "Illumina sequencing of library 13741619  constructed from sample accession ERS715220 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TGAACTGG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#12.cram", "cram", 746397730.0, 5741521.0, "SC RUN 16164 8#12", "0:55 1:75", "A:217959769;C:123138989;G:158254272;T:246531930;N:512770", 55, 75, null, null, 217959769, 123138989, 158254272, 246531930, 512770, "ERX1065711", "ERS715220", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.20695, 0.57674, 0.14123, 0.14978, 0.95899, 0.9138, 0.56705, 0.57522, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13312, "ERR984489", "ERX1065710", "ERS715219", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367567", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367567|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 11 sc 2286391|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 11 sc 2286391|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#11", "13741618", "Illumina sequencing of library 13741618  constructed from sample accession ERS715219 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TTGGTATG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#11.cram", "cram", 630077890.0, 4846753.0, "SC RUN 16164 8#11", "0:55 1:75", "A:181555459;C:107913967;G:131155798;T:209016157;N:436509", 55, 75, null, null, 181555459, 107913967, 131155798, 209016157, 436509, "ERX1065710", "ERS715219", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.23034, 0.58664, 0.14994, 0.16031, 0.9517, 0.9134, 0.43491, 0.55537, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13313, "ERR984488", "ERX1065709", "ERS715218", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367566", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:57Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367566|INSDC center name:SC|INSDC first public:2015 08 18T09:04:57Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 10 sc 2286390|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 10 sc 2286390|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#10", "13741617", "Illumina sequencing of library 13741617  constructed from sample accession ERS715218 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TAACGCTG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#10.cram", "cram", 522425410.0, 4018657.0, "SC RUN 16164 8#10", "0:55 1:75", "A:136789388;C:88820863;G:131305976;T:165156817;N:352366", 55, 75, null, null, 136789388, 88820863, 131305976, 165156817, 352366, "ERX1065709", "ERS715218", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.16976, 0.61187, 0.10677, 0.16777, 0.96096, 0.93093, 0.59603, 0.58893, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13314, "ERR984487", "ERX1065708", "ERS715217", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367565", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367565|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 9 sc 2286389|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 9 sc 2286389|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#9", "13741616", "Illumina sequencing of library 13741616  constructed from sample accession ERS715217 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCGAAGTG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#9.cram", "cram", 662372100.0, 5095170.0, "SC RUN 16164 8#9", "0:55 1:75", "A:186346528;C:114321445;G:137139385;T:224106023;N:458719", 55, 75, null, null, 186346528, 114321445, 137139385, 224106023, 458719, "ERX1065708", "ERS715217", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.22854, 0.63729, 0.14734, 0.16003, 0.95089, 0.90751, 0.51773, 0.50977, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13315, "ERR984486", "ERX1065707", "ERS715216", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367564", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367564|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 8 sc 2286388|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 8 sc 2286388|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#8", "13741615", "Illumina sequencing of library 13741615  constructed from sample accession ERS715216 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TTCCATTG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#8.cram", "cram", 857007060.0, 6592362.0, "SC RUN 16164 8#8", "0:55 1:75", "A:257958701;C:131661477;G:190276240;T:276500331;N:610311", 55, 75, null, null, 257958701, 131661477, 190276240, 276500331, 610311, "ERX1065707", "ERS715216", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.21266, 0.595, 0.14225, 0.14037, 0.95964, 0.92232, 0.54595, 0.53111, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13316, "ERR984485", "ERX1065706", "ERS715215", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367563", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367563|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 7 sc 2286387|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 7 sc 2286387|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#7", "13741614", "Illumina sequencing of library 13741614  constructed from sample accession ERS715215 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TAGTCTTG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#7.cram", "cram", 742942590.0, 5714943.0, "SC RUN 16164 8#7", "0:55 1:75", "A:228799118;C:117009382;G:166056205;T:230565934;N:511951", 55, 75, null, null, 228799118, 117009382, 166056205, 230565934, 511951, "ERX1065706", "ERS715215", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.19264, 0.50767, 0.1428, 0.15173, 0.9666, 0.94606, 0.57413, 0.53902, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13317, "ERR984484", "ERX1065705", "ERS715214", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367562", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367562|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 6 sc 2286386|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 6 sc 2286386|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#6", "13741613", "Illumina sequencing of library 13741613  constructed from sample accession ERS715214 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TGTGGTTG.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#6.cram", "cram", 908951420.0, 6991934.0, "SC RUN 16164 8#6", "0:55 1:75", "A:266807632;C:158160652;G:194742499;T:288619707;N:620930", 55, 75, null, null, 266807632, 158160652, 194742499, 288619707, 620930, "ERX1065705", "ERS715214", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.20021, 0.52069, 0.13208, 0.1197, 0.95775, 0.93324, 0.52946, 0.52456, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13318, "ERR984483", "ERX1065704", "ERS715213", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367561", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367561|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 5 sc 2286385|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 5 sc 2286385|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#5", "13741612", "Illumina sequencing of library 13741612  constructed from sample accession ERS715213 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TCCTCAAT.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#5.cram", "cram", 771659330.0, 5935841.0, "SC RUN 16164 8#5", "0:55 1:75", "A:225161011;C:121434126;G:174639826;T:249876341;N:548026", 55, 75, null, null, 225161011, 121434126, 174639826, 249876341, 548026, "ERX1065704", "ERS715213", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.21069, 0.57513, 0.14228, 0.12501, 0.95672, 0.92488, 0.54397, 0.52111, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13319, "ERR984482", "ERX1065703", "ERS715212", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367560", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367560|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 4 sc 2286384|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 4 sc 2286384|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#4", "13741611", "Illumina sequencing of library 13741611  constructed from sample accession ERS715212 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TACAGGAT.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#4.cram", "cram", 784183790.0, 6032183.0, "SC RUN 16164 8#4", "0:55 1:75", "A:219327080;C:128313123;G:169475262;T:266538585;N:529740", 55, 75, null, null, 219327080, 128313123, 169475262, 266538585, 529740, "ERX1065703", "ERS715212", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.20392, 0.58702, 0.12804, 0.12156, 0.96047, 0.9133, 0.61438, 0.53735, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13320, "ERR984481", "ERX1065702", "ERS715211", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367559", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367559|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 3 sc 2286383|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 3 sc 2286383|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#3", "13741610", "Illumina sequencing of library 13741610  constructed from sample accession ERS715211 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TAGTGACT.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#3.cram", "cram", 810265170.0, 6232809.0, "SC RUN 16164 8#3", "0:55 1:75", "A:237117705;C:130774361;G:170817877;T:270997878;N:557349", 55, 75, null, null, 237117705, 130774361, 170817877, 270997878, 557349, "ERX1065702", "ERS715211", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.22414, 0.5931, 0.14561, 0.13304, 0.95651, 0.91423, 0.59465, 0.54152, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13321, "ERR984480", "ERX1065701", "ERS715210", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367558", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367558|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 2 sc 2286382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 2 sc 2286382|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#2", "13741609", "Illumina sequencing of library 13741609  constructed from sample accession ERS715210 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TTCCTGCT.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#2.cram", "cram", 698194770.0, 5370729.0, "SC RUN 16164 8#2", "0:55 1:75", "A:190784194;C:110138446;G:188418516;T:208362798;N:490816", 55, 75, null, null, 190784194, 110138446, 188418516, 208362798, 490816, "ERX1065701", "ERS715210", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.17398, 0.58306, 0.10399, 0.12476, 0.96372, 0.94468, 0.64309, 0.54721, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [13322, "ERR984479", "ERX1065700", "ERS715209", "ERP006132", "PRJEB6584", "Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project", "Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191", "Transcriptome Analysis", "Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.", null, null, null, null, "SAMEA3367557", "SC", "ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028   Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367557|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 1 sc 2286381|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna  allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 1 sc 2286381|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "SC EXP 16164 8#1", "13741608", "Illumina sequencing of library 13741608  constructed from sample accession ERS715209 for study accession ERP006132.  This is part of an Illumina multiplexed sequencing run 16164 8.  This submission includes reads tagged with the sequence TGCGATCT.", "Transcriptome counting qPCR only", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP006132", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16", "16164_8#1.cram", "cram", 882032060.0, 6784862.0, "SC RUN 16164 8#1", "0:55 1:75", "A:258098215;C:144707482;G:194402683;T:284218124;N:605556", 55, 75, null, null, 258098215, 144707482, 194402683, 284218124, 605556, "ERX1065700", "ERS715209", "ERA466416", "The Wellcome Trust Sanger Institute|European Nucleotide Archive", "Wellcome Sanger Institute", 2, 0.21585, 0.55375, 0.14409, 0.13461, 0.96015, 0.9246, 0.61791, 0.5495, 55, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2015-08-18", "Multi-stage", "Embryo", "Whole Organism", "All anatomical structures"], [24927, "SRR25557778", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L001_R1_001.fastq.gz", "fastq", 420092501.0, 5668059.0, "GSM7688794 r1", "0:74.12", "A:113006440;C:96725832;G:99320773;T:110915967;N:123489", 74, null, null, null, 113006440, 96725832, 99320773, 110915967, 123489, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94757, null, 0.06229, null, 0.72364, null, 0.46676, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24928, "SRR25557779", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L002_R1_001.fastq.gz", "fastq", 421869780.0, 5690053.0, "GSM7688794 r2", "0:74.14", "A:113530489;C:97144227;G:99697959;T:111388539;N:108566", 74, null, null, null, 113530489, 97144227, 99697959, 111388539, 108566, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94921, null, 0.06226, null, 0.72462, null, 0.4738, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24929, "SRR25557780", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L003_R1_001.fastq.gz", "fastq", 425064659.0, 5734041.0, "GSM7688794 r3", "0:74.13", "A:114342253;C:97873100;G:100532599;T:112196433;N:120274", 74, null, null, null, 114342253, 97873100, 100532599, 112196433, 120274, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94886, null, 0.06112, null, 0.72425, null, 0.47055, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24930, "SRR25557781", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L004_R1_001.fastq.gz", "fastq", 416990548.0, 5624902.0, "GSM7688794 r4", "0:74.13", "A:112153356;C:96009158;G:98613145;T:110097476;N:117413", 74, null, null, null, 112153356, 96009158, 98613145, 110097476, 117413, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94869, null, 0.06229, null, 0.72506, null, 0.47222, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24931, "SRR25557782", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L001_R1_001.fastq.gz", "fastq", 434485284.0, 5881416.0, "GSM7688793 r1", "0:73.87", "A:116640351;C:100176557;G:102659919;T:114799536;N:208921", 73, null, null, null, 116640351, 100176557, 102659919, 114799536, 208921, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94533, null, 0.07176, null, 0.72464, null, 0.47632, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24932, "SRR25557783", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L002_R1_001.fastq.gz", "fastq", 435203869.0, 5886556.0, "GSM7688793 r2", "0:73.93", "A:116869356;C:100363580;G:102830644;T:114973504;N:166785", 73, null, null, null, 116869356, 100363580, 102830644, 114973504, 166785, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94542, null, 0.07203, null, 0.72421, null, 0.47733, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24933, "SRR25557784", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L003_R1_001.fastq.gz", "fastq", 439897269.0, 5951878.0, "GSM7688793 r3", "0:73.91", "A:118101648;C:101426657;G:103990006;T:116184480;N:194478", 73, null, null, null, 118101648, 101426657, 103990006, 116184480, 194478, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94486, null, 0.07224, null, 0.72448, null, 0.47915, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24934, "SRR25557785", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L004_R1_001.fastq.gz", "fastq", 431385256.0, 5836029.0, "GSM7688793 r4", "0:73.92", "A:115804970;C:99459059;G:101962932;T:113975935;N:182360", 73, null, null, null, 115804970, 99459059, 101962932, 113975935, 182360, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94432, null, 0.07229, null, 0.7261, null, 0.47463, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24935, "SRR25557786", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L001_R1_001.fastq.gz", "fastq", 513309395.0, 6929648.0, "GSM7688792 r1", "0:74.07", "A:137428462;C:118688804;G:122019962;T:134991729;N:180438", 74, null, null, null, 137428462, 118688804, 122019962, 134991729, 180438, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94188, null, 0.07029, null, 0.73772, null, 0.47692, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24936, "SRR25557787", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L002_R1_001.fastq.gz", "fastq", 517356735.0, 6982196.0, "GSM7688792 r2", "0:74.10", "A:138524037;C:119650852;G:122965491;T:136056171;N:160184", 74, null, null, null, 138524037, 119650852, 122965491, 136056171, 160184, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94281, null, 0.06967, null, 0.73963, null, 0.48142, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24937, "SRR25557788", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L003_R1_001.fastq.gz", "fastq", 519422328.0, 7010631.0, "GSM7688792 r3", "0:74.09", "A:139040684;C:120128748;G:123529198;T:136551898;N:171800", 74, null, null, null, 139040684, 120128748, 123529198, 136551898, 171800, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94297, null, 0.06942, null, 0.73726, null, 0.47499, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24938, "SRR25557789", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L004_R1_001.fastq.gz", "fastq", 511640294.0, 6905748.0, "GSM7688792 r4", "0:74.09", "A:136914638;C:118302866;G:121704665;T:134543505;N:174620", 74, null, null, null, 136914638, 118302866, 121704665, 134543505, 174620, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94176, null, 0.07029, null, 0.73868, null, 0.47987, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24939, "SRR25557790", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L001_R1_001.fastq.gz", "fastq", 429446821.0, 5803178.0, "GSM7688791 r1", "0:74.00", "A:114793535;C:99506379;G:102226914;T:112748761;N:171232", 74, null, null, null, 114793535, 99506379, 102226914, 112748761, 171232, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94175, null, 0.06669, null, 0.73673, null, 0.48179, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24940, "SRR25557791", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L002_R1_001.fastq.gz", "fastq", 434629893.0, 5870828.0, "GSM7688791 r2", "0:74.03", "A:116216940;C:100703527;G:103463365;T:114092681;N:153380", 74, null, null, null, 116216940, 100703527, 103463365, 114092681, 153380, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94143, null, 0.0676, null, 0.73791, null, 0.48091, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24942, "SRR25557793", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L004_R1_001.fastq.gz", "fastq", 429478475.0, 5801978.0, "GSM7688791 r4", "0:74.02", "A:114799280;C:99474677;G:102302775;T:112737475;N:164268", 74, null, null, null, 114799280, 99474677, 102302775, 112737475, 164268, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94118, null, 0.06706, null, 0.73892, null, 0.47732, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24943, "SRR25557794", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L001_R1_001.fastq.gz", "fastq", 459545188.0, 6215897.0, "GSM7688790 r1", "0:73.93", "A:121926568;C:107379723;G:110263606;T:119766429;N:208862", 73, null, null, null, 121926568, 107379723, 110263606, 119766429, 208862, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94273, null, 0.06072, null, 0.74582, null, 0.47499, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24944, "SRR25557795", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L002_R1_001.fastq.gz", "fastq", 463143624.0, 6261406.0, "GSM7688790 r2", "0:73.97", "A:122917997;C:108229793;G:111099867;T:120713978;N:181989", 73, null, null, null, 122917997, 108229793, 111099867, 120713978, 181989, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94387, null, 0.06093, null, 0.74341, null, 0.47351, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24945, "SRR25557796", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L003_R1_001.fastq.gz", "fastq", 465959664.0, 6300929.0, "GSM7688790 r3", "0:73.95", "A:123689364;C:108847593;G:111847868;T:121377463;N:197376", 73, null, null, null, 123689364, 108847593, 111847868, 121377463, 197376, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94322, null, 0.06219, null, 0.74357, null, 0.47977, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24946, "SRR25557797", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L004_R1_001.fastq.gz", "fastq", 459075430.0, 6207363.0, "GSM7688790 r4", "0:73.96", "A:121797426;C:107221116;G:110209684;T:119657308;N:189896", 73, null, null, null, 121797426, 107221116, 110209684, 119657308, 189896, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94313, null, 0.06211, null, 0.74343, null, 0.47801, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24947, "SRR25557798", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L001_R1_001.fastq.gz", "fastq", 439719566.0, 5947052.0, "GSM7688787 r1", "0:73.94", "A:117482073;C:102083665;G:104685444;T:115272860;N:195524", 73, null, null, null, 117482073, 102083665, 104685444, 115272860, 195524, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94829, null, 0.06278, null, 0.72525, null, 0.46494, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24948, "SRR25557799", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L002_R1_001.fastq.gz", "fastq", 438533503.0, 5927990.0, "GSM7688787 r2", "0:73.98", "A:117199594;C:101810881;G:104402169;T:114946611;N:174248", 73, null, null, null, 117199594, 101810881, 104402169, 114946611, 174248, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94887, null, 0.06387, null, 0.72827, null, 0.46616, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24949, "SRR25557800", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L003_R1_001.fastq.gz", "fastq", 443995554.0, 6003540.0, "GSM7688787 r3", "0:73.96", "A:118663936;C:103031716;G:105723574;T:116387834;N:188494", 73, null, null, null, 118663936, 103031716, 105723574, 116387834, 188494, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94788, null, 0.06232, null, 0.72693, null, 0.46653, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24950, "SRR25557801", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L004_R1_001.fastq.gz", "fastq", 435088869.0, 5882642.0, "GSM7688787 r4", "0:73.96", "A:116261447;C:100986653;G:103615584;T:114042354;N:182831", 73, null, null, null, 116261447, 100986653, 103615584, 114042354, 182831, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94914, null, 0.06241, null, 0.72829, null, 0.4546, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24951, "SRR25557802", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L001_R1_001.fastq.gz", "fastq", 395130702.0, 5338263.0, "GSM7688785 r1", "0:74.02", "A:107005793;C:90183031;G:92316770;T:105476481;N:148627", 74, null, null, null, 107005793, 90183031, 92316770, 105476481, 148627, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94534, null, 0.07625, null, 0.73888, null, 0.48135, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24952, "SRR25557803", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L002_R1_001.fastq.gz", "fastq", 396764458.0, 5358448.0, "GSM7688785 r2", "0:74.04", "A:107513717;C:90540282;G:92658504;T:105917444;N:134511", 74, null, null, null, 107513717, 90540282, 92658504, 105917444, 134511, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94374, null, 0.07709, null, 0.73878, null, 0.47615, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24953, "SRR25557804", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L003_R1_001.fastq.gz", "fastq", 399623551.0, 5397520.0, "GSM7688785 r3", "0:74.04", "A:108230540;C:91192011;G:93388052;T:106665106;N:147842", 74, null, null, null, 108230540, 91192011, 93388052, 106665106, 147842, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94399, null, 0.07657, null, 0.73797, null, 0.4794, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24954, "SRR25557805", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L004_R1_001.fastq.gz", "fastq", 393298978.0, 5312101.0, "GSM7688785 r4", "0:74.04", "A:106518845;C:89734564;G:91901232;T:105004490;N:139847", 74, null, null, null, 106518845, 89734564, 91901232, 105004490, 139847, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94423, null, 0.07599, null, 0.73884, null, 0.47905, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24955, "SRR25557806", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L001_R1_001.fastq.gz", "fastq", 366045799.0, 4944832.0, "GSM7688783 r1", "0:74.03", "A:98000119;C:84654222;G:86951226;T:96295351;N:144881", 74, null, null, null, 98000119, 84654222, 86951226, 96295351, 144881, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94303, null, 0.07499, null, 0.73085, null, 0.47881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24956, "SRR25557807", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L002_R1_001.fastq.gz", "fastq", 369429068.0, 4988719.0, "GSM7688783 r2", "0:74.05", "A:98907882;C:85446993;G:87729593;T:97216477;N:128123", 74, null, null, null, 98907882, 85446993, 87729593, 97216477, 128123, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94261, null, 0.07335, null, 0.72969, null, 0.47867, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24957, "SRR25557808", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L003_R1_001.fastq.gz", "fastq", 369967330.0, 4996710.0, "GSM7688783 r3", "0:74.04", "A:99035743;C:85549878;G:87926587;T:97310812;N:144310", 74, null, null, null, 99035743, 85549878, 87926587, 97310812, 144310, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94328, null, 0.0743, null, 0.73034, null, 0.47133, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24958, "SRR25557809", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L004_R1_001.fastq.gz", "fastq", 365499176.0, 4936305.0, "GSM7688783 r4", "0:74.04", "A:97825658;C:84517732;G:86863655;T:96157429;N:134702", 74, null, null, null, 97825658, 84517732, 86863655, 96157429, 134702, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94286, null, 0.07288, null, 0.72999, null, 0.4783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24959, "SRR25557810", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L001_R1_001.fastq.gz", "fastq", 488585907.0, 6585668.0, "GSM7688782 r1", "0:74.19", "A:131727468;C:112349971;G:115189425;T:129203159;N:115884", 74, null, null, null, 131727468, 112349971, 115189425, 129203159, 115884, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93794, null, 0.07381, null, 0.7315, null, 0.47355, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24960, "SRR25557811", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L002_R1_001.fastq.gz", "fastq", 493766544.0, 6653820.0, "GSM7688782 r2", "0:74.21", "A:133135166;C:113551418;G:116398455;T:130575771;N:105734", 74, null, null, null, 133135166, 113551418, 116398455, 130575771, 105734, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93729, null, 0.07312, null, 0.7307, null, 0.47966, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24961, "SRR25557812", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L003_R1_001.fastq.gz", "fastq", 494935071.0, 6670024.0, "GSM7688782 r3", "0:74.20", "A:133406912;C:113769494;G:116771560;T:130871612;N:115493", 74, null, null, null, 133406912, 113769494, 116771560, 130871612, 115493, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93847, null, 0.07383, null, 0.73194, null, 0.47646, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"]], "truncated": false, "filtered_table_rows_count": 3724, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"experiment.library_selection\" = :p1 order by rowid limit 101", "params": {"p0": "Multi-stage", "p1": "cDNA"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 3720, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.library_strategy=miRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 3622, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 102, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "cDNA", "label": "cDNA", "count": 3724, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 2844, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 880, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 3584, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.platform=ILLUMINA", "selected": false}, {"value": "BGISEQ", "label": "BGISEQ", "count": 54, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.platform=BGISEQ", "selected": false}, {"value": "DNBSEQ", "label": "DNBSEQ", "count": 48, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.platform=DNBSEQ", "selected": false}, {"value": "ELEMENT", "label": "ELEMENT", "count": 30, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.platform=ELEMENT", "selected": false}, {"value": "ION_TORRENT", "label": "ION_TORRENT", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&experiment.platform=ION_TORRENT", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "Multi-stage", "label": "Multi-stage", "count": 1875, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&devstage_curation_coarse=Multi-stage", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 1849, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "Multi-stage", "label": "Multi-stage", "count": 3724, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 2710, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=All+anatomical+structures", "selected": false}, {"value": "Nervous System", "label": "Nervous System", "count": 314, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Surface Structure", "label": "Surface Structure", "count": 123, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Surface+Structure", "selected": false}, {"value": "Liver and Biliary System", "label": "Liver and Biliary System", "count": 100, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Liver+and+Biliary+System", "selected": false}, {"value": "Sensory System", "label": "Sensory System", "count": 96, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Sensory+System", "selected": false}, {"value": "Multi-system", "label": "Multi-system", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Multi-system", "selected": false}, {"value": "Renal System", "label": "Renal System", "count": 58, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Renal+System", "selected": false}, {"value": "Cardiovascular System", "label": "Cardiovascular System", "count": 54, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Cardiovascular+System", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 45, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Undetermined", "selected": false}, {"value": "Muscular System", "label": "Muscular System", "count": 33, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation_coarse=Muscular+System", "selected": false}], "truncated": true}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 1760, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Embryo+Imprecise", "selected": false}, {"value": "Whole Organism", "label": "Whole Organism", "count": 950, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Whole+Organism", "selected": false}, {"value": "Brain", "label": "Brain", "count": 160, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Brain", "selected": false}, {"value": "Liver", "label": "Liver", "count": 100, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Liver", "selected": false}, {"value": "Trunk", "label": "Trunk", "count": 100, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Trunk", "selected": false}, {"value": "Head", "label": "Head", "count": 90, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Head", "selected": false}, {"value": "Eye", "label": "Eye", "count": 84, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Eye", "selected": false}, {"value": "Spinal Cord", "label": "Spinal Cord", "count": 64, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Spinal+Cord", "selected": false}, {"value": "Tail", "label": "Tail", "count": 64, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Tail", "selected": false}, {"value": "Kidney", "label": "Kidney", "count": 58, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&tissue_curation=Kidney", "selected": false}], "truncated": true}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA", "results": [{"value": "unknown", "label": "unknown", "count": 1884, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&technology=unknown", "selected": false}, {"value": "smartseq", "label": "smartseq", "count": 1308, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&technology=smartseq", "selected": false}, {"value": "bulk", "label": "bulk", "count": 310, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&technology=bulk", "selected": false}, {"value": "10x", "label": "10x", "count": 135, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&technology=10x", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 76, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&technology=generic-scrnaseq-only", "selected": false}, {"value": "celseq", "label": "celseq", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&technology=celseq", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "24961", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Multi-stage&experiment.library_selection=cDNA&_next=24961", "private": false, "allow_execute_sql": true, "query_ms": 166.19969499879517}