{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Larval\" and experiment.library_strategy = \"ncRNA-Seq\"", "rows": [[25162, "SRR25655085", "SRX21381122", "SRS18622091", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 8 AU1038 STRSS4", "GSM7712891", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing", "Sample 8 AU1038 STRSS4", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:From parent chronically stressed", "GSM7712891", "GSM7712891: Sample 8 AU1038 STRSS4; Danio rerio; ncRNA Seq", "GSM7712891 r1", "GSM7712891", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "STRS04_10932AAD_TGTCCTAC-ACATGAGT_R1_001.fastq.gz", "fastq", 641236400.0, 12824728.0, "GSM7712891 r1", "0:50", "A:183546979;C:159774155;G:156033079;T:141881902;N:285", 50, null, null, null, 183546979, 159774155, 156033079, 141881902, 285, "SRX21381122", "SRS18622091", "SRA1693666", "CNAG", "CNAG", 1, 0.4736, null, 0.03992, null, 0.96788, null, 0.87662, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25163, "SRR25655086", "SRX21381121", "SRS18622090", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 7 AU1037 STRSS3", "GSM7712890", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing", "Sample 7 AU1037 STRSS3", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:From parent chronically stressed", "GSM7712890", "GSM7712890: Sample 7 AU1037 STRSS3; Danio rerio; ncRNA Seq", "GSM7712890 r1", "GSM7712890", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "STRS03_10931AAD_GCACGATT-CGTCTGCA_R1_001.fastq.gz", "fastq", 434646850.0, 8692937.0, "GSM7712890 r1", "0:50", "A:126760670;C:102577685;G:109591447;T:95716876;N:172", 50, null, null, null, 126760670, 102577685, 109591447, 95716876, 172, "SRX21381121", "SRS18622090", "SRA1693666", "CNAG", "CNAG", 1, 0.52132, null, 0.04615, null, 0.96477, null, 0.85481, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25164, "SRR25655087", "SRX21381120", "SRS18622089", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 6 AU1036 STRSS2", "GSM7712889", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing", "Sample 6 AU1036 STRSS2", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:From parent chronically stressed", "GSM7712889", "GSM7712889: Sample 6 AU1036 STRSS2; Danio rerio; ncRNA Seq", "GSM7712889 r1", "GSM7712889", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "STRS02_10930AAD_ATGAAGCG-GCGGACAG_R1_001.fastq.gz", "fastq", 907610650.0, 18152213.0, "GSM7712889 r1", "0:50", "A:271494673;C:215304417;G:220608756;T:200202267;N:537", 50, null, null, null, 271494673, 215304417, 220608756, 200202267, 537, "SRX21381120", "SRS18622089", "SRA1693666", "CNAG", "CNAG", 1, 0.44189, null, 0.03477, null, 0.97335, null, 0.88092, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25165, "SRR25655088", "SRX21381119", "SRS18622088", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 5 AU1035 STRSS1", "GSM7712888", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing", "Sample 5 AU1035 STRSS1", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:From parent chronically stressed", "GSM7712888", "GSM7712888: Sample 5 AU1035 STRSS1; Danio rerio; ncRNA Seq", "GSM7712888 r1", "GSM7712888", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "STRS01_10929AAD_CACTTCGA-TAGGCTTC_R1_001.fastq.gz", "fastq", 711276100.0, 14225522.0, "GSM7712888 r1", "0:50", "A:207284968;C:173540770;G:172961619;T:157488473;N:270", 50, null, null, null, 207284968, 173540770, 172961619, 157488473, 270, "SRX21381119", "SRS18622088", "SRA1693666", "CNAG", "CNAG", 1, 0.47865, null, 0.03881, null, 0.97001, null, 0.87616, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25166, "SRR25655089", "SRX21381118", "SRS18622087", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 4 AU1028 CTRL4", "GSM7712887", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing", "Sample 4 AU1028 CTRL4", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:Control", "GSM7712887", "GSM7712887: Sample 4 AU1028 CTRL4; Danio rerio; ncRNA Seq", "GSM7712887 r1", "GSM7712887", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "CTRL04_10928AAD_GACTAGGC-GCCTCGAC_R1_001.fastq.gz", "fastq", 568037350.0, 11360747.0, "GSM7712887 r1", "0:50", "A:165826590;C:133109854;G:141956673;T:127143732;N:501", 50, null, null, null, 165826590, 133109854, 141956673, 127143732, 501, "SRX21381118", "SRS18622087", "SRA1693666", "CNAG", "CNAG", 1, 0.48051, null, 0.0347, null, 0.97268, null, 0.87465, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25167, "SRR25655090", "SRX21381117", "SRS18622086", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 3 AU1027 CTRL3", "GSM7712886", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing", "Sample 3 AU1027 CTRL3", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:Control", "GSM7712886", "GSM7712886: Sample 3 AU1027 CTRL3; Danio rerio; ncRNA Seq", "GSM7712886 r1", "GSM7712886", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "CTRL03_10927AAD_AGTATACT-CGAATCGG_R1_001.fastq.gz", "fastq", 651469300.0, 13029386.0, "GSM7712886 r1", "0:50", "A:191788726;C:154951271;G:161329211;T:143399936;N:156", 50, null, null, null, 191788726, 154951271, 161329211, 143399936, 156, "SRX21381117", "SRS18622086", "SRA1693666", "CNAG", "CNAG", 1, 0.45412, null, 0.04073, null, 0.96934, null, 0.88507, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25168, "SRR25655091", "SRX21381116", "SRS18622085", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 2 AU1026 CTRL2", "GSM7712885", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing", "Sample 2 AU1026 CTRL2", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:Control", "GSM7712885", "GSM7712885: Sample 2 AU1026 CTRL2; Danio rerio; ncRNA Seq", "GSM7712885 r1", "GSM7712885", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "CTRL02_10926AAD_CCGCGTAG-TTCTGATT_R1_001.fastq.gz", "fastq", 754615100.0, 15092302.0, "GSM7712885 r1", "0:50", "A:217013981;C:184328493;G:188964773;T:164307508;N:345", 50, null, null, null, 217013981, 184328493, 188964773, 164307508, 345, "SRX21381116", "SRS18622085", "SRA1693666", "CNAG", "CNAG", 1, 0.48926, null, 0.04654, null, 0.96418, null, 0.8889, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [25169, "SRR25655092", "SRX21381115", "SRS18622084", "SRP455342", "PRJNA1005926", "miR 29a is downregulated in progenies derived from chronically stressed males", "GSE240954", "Transcriptome Analysis", "To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.", null, "pubmed:37762407", null, "Sample 1 AU1024 CTRL1", "GSM7712884", null, "source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing", "Sample 1 AU1024 CTRL1", "Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts", "larvae", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:larvae|genotype:WT|treatment:Control", "GSM7712884", "GSM7712884: Sample 1 AU1024 CTRL1; Danio rerio; ncRNA Seq", "GSM7712884 r1", "GSM7712884", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP455342", null, "loader:fastq load.py", "CTRL01_10925AAD_TTAGCCTA-AATCATCA_R1_001.fastq.gz", "fastq", 670580700.0, 13411614.0, "GSM7712884 r1", "0:50", "A:194653643;C:158916446;G:165941477;T:151068917;N:217", 50, null, null, null, 194653643, 158916446, 165941477, 151068917, 217, "SRX21381115", "SRS18622084", "SRA1693666", "CNAG", "CNAG", 1, 0.47093, null, 0.03457, null, 0.97187, null, 0.8867, null, 50, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2023-08-16", "Larval", "Larval", "Undetermined", "Undetermined"], [37985, "SRR1216351", "SRX510531", "SRS588958", "SRP040940", "PRJNA243510", "Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish", "GSE56498", "Transcriptome Analysis", "ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "parent bioproject:PRJNA541472", "pubmed:24874946", null, "nls Cherry Ethanol #2", "GSM1362715", null, "tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "nls Cherry Ethanol #2", "Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.", "Zebrafish 5 dpf liver", null, "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", null, "tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "GSM1362715", "GSM1362715: nls Cherry Ethanol #2; Danio rerio; ncRNA Seq", "GSM1362715", null, "1", "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "GEO Accession:GSM1362715", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP040940", null, null, "Cherry2-ethanol_raw.txt.gz", "fastq", 2547597500.0, 25475975.0, "GSM1362715 r1", "0:100", "A:667878423;C:617022069;G:603019059;T:656604341;N:3073608", 100, null, null, null, 667878423, 617022069, 603019059, 656604341, 3073608, "SRX510531", "SRS588958", "SRA156310", "GEO", "sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai", 1, 0.903, null, 0.06203, null, 0.78173, null, 0.47105, null, 100, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2014-04-03", "Larval", "Larval", "Liver", "Liver and Biliary System"], [37986, "SRR1216350", "SRX510530", "SRS588959", "SRP040940", "PRJNA243510", "Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish", "GSE56498", "Transcriptome Analysis", "ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "parent bioproject:PRJNA541472", "pubmed:24874946", null, "nls Cherry Ethanol #1", "GSM1362714", null, "tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "nls Cherry Ethanol #1", "Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.", "Zebrafish 5 dpf liver", null, "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", null, "tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "GSM1362714", "GSM1362714: nls Cherry Ethanol #1; Danio rerio; ncRNA Seq", "GSM1362714", null, "1", "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "GEO Accession:GSM1362714", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP040940", null, null, "Cherry1-ethanol_raw.txt.gz", "fastq", 2848772300.0, 28487723.0, "GSM1362714 r1", "0:100", "A:754173668;C:673034180;G:669171787;T:748900638;N:3492027", 100, null, null, null, 754173668, 673034180, 669171787, 748900638, 3492027, "SRX510530", "SRS588959", "SRA156310", "GEO", "sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai", 1, 0.93424, null, 0.04344, null, 0.80365, null, 0.45184, null, 100, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2014-04-03", "Larval", "Larval", "Liver", "Liver and Biliary System"], [37987, "SRR1216349", "SRX510529", "SRS588957", "SRP040940", "PRJNA243510", "Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish", "GSE56498", "Transcriptome Analysis", "ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "parent bioproject:PRJNA541472", "pubmed:24874946", null, "nAtf6 Cherry #1", "GSM1362713", null, "tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf", "nAtf6 Cherry #1", "Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.", "Zebrafish 5 dpf liver", null, "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", null, "tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf", "GSM1362713", "GSM1362713: nAtf6 Cherry #1; Danio rerio; ncRNA Seq", "GSM1362713", null, "1", "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "GEO Accession:GSM1362713", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP040940", null, null, "nAtf61_raw.txt.gz", "fastq", 2259581400.0, 22595814.0, "GSM1362713 r1", "0:100", "A:577752854;C:550694305;G:551105918;T:577235877;N:2792446", 100, null, null, null, 577752854, 550694305, 551105918, 577235877, 2792446, "SRX510529", "SRS588957", "SRA156310", "GEO", "sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai", 1, 0.94581, null, 0.04947, null, 0.80375, null, 0.52352, null, 100, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2014-04-03", "Larval", "Larval", "Liver", "Liver and Biliary System"], [37988, "SRR1216348", "SRX510528", "SRS588956", "SRP040940", "PRJNA243510", "Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish", "GSE56498", "Transcriptome Analysis", "ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "parent bioproject:PRJNA541472", "pubmed:24874946", null, "nls Cherry #2", "GSM1362712", null, "tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "nls Cherry #2", "Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.", "Zebrafish 5 dpf liver", null, "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", null, "tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "GSM1362712", "GSM1362712: nls Cherry #2; Danio rerio; ncRNA Seq", "GSM1362712", null, "1", "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "GEO Accession:GSM1362712", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP040940", null, null, "Cherry2_raw.txt.gz", "fastq", 2132003100.0, 21320031.0, "GSM1362712 r1", "0:100", "A:536532013;C:533562250;G:522685362;T:536641910;N:2581565", 100, null, null, null, 536532013, 533562250, 522685362, 536641910, 2581565, "SRX510528", "SRS588956", "SRA156310", "GEO", "sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai", 1, 0.88352, null, 0.04379, null, 0.81947, null, 0.52367, null, 100, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2014-04-03", "Larval", "Larval", "Liver", "Liver and Biliary System"], [37989, "SRR1216347", "SRX510527", "SRS588955", "SRP040940", "PRJNA243510", "Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish", "GSE56498", "Transcriptome Analysis", "ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "parent bioproject:PRJNA541472", "pubmed:24874946", null, "nls Cherry #1", "GSM1362711", null, "tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "nls Cherry #1", "Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.", "Zebrafish 5 dpf liver", null, "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", null, "tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf", "GSM1362711", "GSM1362711: nls Cherry #1; Danio rerio; ncRNA Seq", "GSM1362711", null, "1", "Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.", "GEO Accession:GSM1362711", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP040940", null, null, "Cherry1_raw.txt.gz", "fastq", 2098395500.0, 20983955.0, "GSM1362711 r1", "0:100", "A:533756912;C:521877600;G:512200617;T:528020965;N:2539406", 100, null, null, null, 533756912, 521877600, 512200617, 528020965, 2539406, "SRX510527", "SRS588955", "SRA156310", "GEO", "sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai", 1, 0.89447, null, 0.02865, null, 0.82436, null, 0.50802, null, 100, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2014-04-03", "Larval", "Larval", "Liver", "Liver and Biliary System"], [41250, "SRR3987432", "SRX1989729", "SRS1593551", "SRP080353", "PRJNA335856", "High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under \u00df diketone antibiotics exposure to F0 zebrafish", "GSE85004", "Transcriptome Analysis", "Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day \u00df diketone\u00a0antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.", null, null, null, "S12 F1", "GSM2255739", null, "source name:F1 zebrafish 7 dpf F0 12.5 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:12.5 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf", "S12 F1", "Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3\u2019 and 5\u2019 ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the predicted hairpin >=12; and 11 percent of mature in stem >=80. For normalized abundance measurements a modified global normalization is used to correct copy numbers among different samples. Basic assumptions and procedures involved in this method are: 1. There is a subset of sequences of a significant number that do not change significantly across all samples. 2. In sequencing measurements experimental condition variations may lead to copy number reading variations. However in each sample run the reading variations occur in the same proportion to all sequences. This assumption permits the use of a single correction factor for all sequences in a sample. Genome build: Zv9 ftp://ftp.ensembl.org/pub/release 66/fasta/danio rerio/dna/ Supplementary files format and content: Table8.2 S12 F1vsS6 F1vsCON F1.xlsx indicates the differential expression between two DKA exposure treatments 6.25 and 12.5 mg/L treatments and control. Supplementary files format and content: Table8.6 S12 F1vsS6 F1.xlsx indicates the differential expression between 6.25 mg/L and 12.5 mg/L DKA exposure treatments. Supplementary files format and content: Table8.7 S6 F1vsCON F1.xlsx indicates the differential expression between 6.25 mg/L DKA exposure treatment and control. Supplementary files format and content: Table8.8 S12 F1vsCON F1.xlsx indicates the differential expression between 12.5 mg/L DKA exposure treatment and control.", "F1 zebrafish 7 dpf F0 12.5 mg/L DKA exposure", "Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%.", "Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer\u2019s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 \u03bcg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor\u2019s recommended protocol.", null, "strain/background:AB|genotype/variation:WT|f0 treatment:12.5 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf", "GSM2255739", "GSM2255739: S12 F1; Danio rerio; ncRNA Seq", "GSM2255739", null, "1", "Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer\u2019s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 \u03bcg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor\u2019s recommended protocol.", "GEO Accession:GSM2255739", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP080353", null, null, "S12_F1.fq", "fastq", 602497450.0, 12049949.0, "GSM2255739 r1", "0:50", "A:147750395;C:138369661;G:162147841;T:153975593;N:253960", 50, null, null, null, 147750395, 138369661, 162147841, 153975593, 253960, "SRX1989729", "SRS1593551", "SRA446490", "GEO", "Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 50, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "China", "2016-07-29", "Larval", "Larval", "Trunk", "Surface Structure"], [41251, "SRR3987431", "SRX1989728", "SRS1593550", "SRP080353", "PRJNA335856", "High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under \u00df diketone antibiotics exposure to F0 zebrafish", "GSE85004", "Transcriptome Analysis", "Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day \u00df diketone\u00a0antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.", null, null, null, "S6 F1", "GSM2255738", null, "source name:F1 zebrafish 7 dpf F0 6.25 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:6.25 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf", "S6 F1", "Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3\u2019 and 5\u2019 ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the predicted hairpin >=12; and 11 percent of mature in stem >=80. For normalized abundance measurements a modified global normalization is used to correct copy numbers among different samples. Basic assumptions and procedures involved in this method are: 1. There is a subset of sequences of a significant number that do not change significantly across all samples. 2. In sequencing measurements experimental condition variations may lead to copy number reading variations. However in each sample run the reading variations occur in the same proportion to all sequences. This assumption permits the use of a single correction factor for all sequences in a sample. Genome build: Zv9 ftp://ftp.ensembl.org/pub/release 66/fasta/danio rerio/dna/ Supplementary files format and content: Table8.2 S12 F1vsS6 F1vsCON F1.xlsx indicates the differential expression between two DKA exposure treatments 6.25 and 12.5 mg/L treatments and control. Supplementary files format and content: Table8.6 S12 F1vsS6 F1.xlsx indicates the differential expression between 6.25 mg/L and 12.5 mg/L DKA exposure treatments. Supplementary files format and content: Table8.7 S6 F1vsCON F1.xlsx indicates the differential expression between 6.25 mg/L DKA exposure treatment and control. Supplementary files format and content: Table8.8 S12 F1vsCON F1.xlsx indicates the differential expression between 12.5 mg/L DKA exposure treatment and control.", "F1 zebrafish 7 dpf F0 6.25 mg/L DKA exposure", "Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%.", "Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer\u2019s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 \u03bcg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor\u2019s recommended protocol.", null, "strain/background:AB|genotype/variation:WT|f0 treatment:6.25 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf", "GSM2255738", "GSM2255738: S6 F1; Danio rerio; ncRNA Seq", "GSM2255738", null, "1", "Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer\u2019s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 \u03bcg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor\u2019s recommended protocol.", "GEO Accession:GSM2255738", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP080353", null, null, "S6_F1.fq", "fastq", 490941500.0, 9818830.0, "GSM2255738 r1", "0:50", "A:119942635;C:111532763;G:133144810;T:126303825;N:17467", 50, null, null, null, 119942635, 111532763, 133144810, 126303825, 17467, "SRX1989728", "SRS1593550", "SRA446490", "GEO", "Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province", 1, 1e-05, null, 0.0, null, 1.0, null, null, null, 50, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "China", "2016-07-29", "Larval", "Larval", "Trunk", "Surface Structure"], [41252, "SRR3987430", "SRX1989727", "SRS1593549", "SRP080353", "PRJNA335856", "High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under \u00df diketone antibiotics exposure to F0 zebrafish", "GSE85004", "Transcriptome Analysis", "Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day \u00df diketone\u00a0antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.", null, null, null, "CON F1", "GSM2255737", null, "source name:F1 zebrafish 7 dpf F0 0 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:0 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf", "CON F1", "Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3\u2019 and 5\u2019 ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the predicted hairpin >=12; and 11 percent of mature in stem >=80. For normalized abundance measurements a modified global normalization is used to correct copy numbers among different samples. Basic assumptions and procedures involved in this method are: 1. There is a subset of sequences of a significant number that do not change significantly across all samples. 2. In sequencing measurements experimental condition variations may lead to copy number reading variations. However in each sample run the reading variations occur in the same proportion to all sequences. This assumption permits the use of a single correction factor for all sequences in a sample. Genome build: Zv9 ftp://ftp.ensembl.org/pub/release 66/fasta/danio rerio/dna/ Supplementary files format and content: Table8.2 S12 F1vsS6 F1vsCON F1.xlsx indicates the differential expression between two DKA exposure treatments 6.25 and 12.5 mg/L treatments and control. Supplementary files format and content: Table8.6 S12 F1vsS6 F1.xlsx indicates the differential expression between 6.25 mg/L and 12.5 mg/L DKA exposure treatments. Supplementary files format and content: Table8.7 S6 F1vsCON F1.xlsx indicates the differential expression between 6.25 mg/L DKA exposure treatment and control. Supplementary files format and content: Table8.8 S12 F1vsCON F1.xlsx indicates the differential expression between 12.5 mg/L DKA exposure treatment and control.", "F1 zebrafish 7 dpf F0 0 mg/L DKA exposure", "Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%.", "Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer\u2019s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 \u03bcg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor\u2019s recommended protocol.", null, "strain/background:AB|genotype/variation:WT|f0 treatment:0 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf", "GSM2255737", "GSM2255737: CON F1; Danio rerio; ncRNA Seq", "GSM2255737", null, "1", "Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer\u2019s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 \u03bcg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor\u2019s recommended protocol.", "GEO Accession:GSM2255737", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP080353", null, null, "CON_F1.fq", "fastq", 505867350.0, 10117347.0, "GSM2255737 r1", "0:50", "A:123471791;C:114424623;G:138931875;T:129020913;N:18148", 50, null, null, null, 123471791, 114424623, 138931875, 129020913, 18148, "SRX1989727", "SRS1593549", "SRA446490", "GEO", "Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province", 1, 2e-05, null, 0.0, null, 0.99993, null, 0.66666, null, 50, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "China", "2016-07-29", "Larval", "Larval", "Trunk", "Surface Structure"], [49332, "SRR7888761", "SRX4726390", "SRS3810123", "SRP162319", "PRJNA492406", "Profiles analysis reveals circRNAs involving zebrafish physiological development", "GSE120289", "Transcriptome Analysis", "Recent studies have found that known functions of circRNAs include sequestration of microRNAs or proteins modulation of transcription and interference with splicing and even translation to produce poly peptides. The zebrafish model is also demonstrably similar to humans in many studies. In order to explore the changes in circRNAs during embryonic development further to research the mechanism of action of circRNAs in development related diseases. Zebrafish embryos at blastula period gastrula period segmentation period throat stage and incubation period were collected. Illumina deep sequencing technology and CIRI algorithm were used to detecting circRNAs. Totally we identified 1028 circRNAs junction reads = 5 and p < 0.05. Considering that circRNAs function is related to host genes then bioinformatics analysis revealed these differentially expressed host genes are involved in NOTCH signaling pathways cardiovascular system development retinal ganglion cell axon guidance and so on. Moreover circRNAs can participate in biological regulation through miRNA sponges function. TargetScan and miRanda were used to predict 73 miRNAs binding to circRNAs such as miR 19b miR 124 and so on some miRNAs play important roles in embryogenesis. The peak expression of circRNAs is distributed at different time points suggesting that it may be involved in embryogenesis at different stages. Our study provides a foundation for understanding the dynamic regulation of circRNA transcriptomes during embryogenesis and identifies novel key circRNAs that might control embryonic development in zebrafish model. Overall design: circRNAs of five periods blastula gastrula segmentation throat and incubation in zebrafish were detected by deep sequencing using Illumina HiSeq 2500.", null, null, null, "72h", "GSM3397729", null, "source name:Embryo|tissue:Embryo|age:72 hpf|developmental stage:incubation|strain:Tubingenz|genotype:WT", "72h", "Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to z10 whole genome using bwa 0.7.5a r405 with parameters \"mem T 19\". CircRNA prediction of sequencing results by CIRI algorithm v1.1. SRPBM Spliced Reads per Billion Mapped Reads=number of circular reads/number of mapped reads units in billion/read length used to normalize the expression of circRNAs. For differential expression analysis of circRNAs raw counts of reads that spanned a particular head to tail junction were analyzed using edgeR package version 3.12.1 with TMM normalization in generalized linear model. The Trimmed Mean of M values TMM normalization method was used to remove the size basis of sequencing libraries between samples. The following criteria were used to screen out significantly differentially expressed circRNAs: Fold change FC \u22652 and p< 0.05. Genome build: z10 Supplementary files format and content: tab delimited text files include SRPBM values and junction reads for each Sample.", "Embryo", "Zebrafish were reared at 28\u00b11\u2103 in a water circulatory system that osmotic pressure stability UV disinfects and aerates the recycled water.The embryos were obtained post spontaneous mating from sexually mature wild type WT adult fish and cultivated at 28.5\u00b10.5\u2103. Morphological features were used to judge the stage of embryonic development.", "Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer\u2019s protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer\u2019s instructions Illumina", null, "tissue:Embryo|age:72 hpf|developmental stage:incubation|strain:Tubingenz|genotype:WT", "GSM3397729", "GSM3397729: 72h; Danio rerio; ncRNA Seq", "GSM3397729", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer's protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer's instructions Illumina", "GEO Accession:GSM3397729", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162319", null, null, "72h_1.fq.gz 72h_2.fq.gz", "fastq fastq", 12097159200.0, 40323864.0, "GSM3397729 r1", "0:150 1:150", "A:2809307023;C:3169515166;G:3184429517;T:2931448896;N:2458598", 150, 150, null, null, 2809307023, 3169515166, 3184429517, 2931448896, 2458598, "SRX4726390", "SRS3810123", "SRA781248", "GEO", "Department of Pediatrics, Nanjing Maternity and Child Health Care Hospital", 2, 0.90426, 0.90717, 0.27165, 0.26439, 0.70739, 0.72397, 0.60155, 0.60561, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-09-21", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [55882, "SRR10863050", "SRX7533045", "SRS5972243", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 3dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 3dpf", "imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1", "imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_08_46_3dpf_PGCs_rep2_S8.R1.fastq.gz", "fastq", 3852707292.0, 45865563.0, "imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1.fastq.gz", "0:84 1:0", "A:980860932;C:926253063;G:920737181;T:1024819575;N:36541", 84, 0, null, null, 980860932, 926253063, 920737181, 1024819575, 36541, "SRX7533045", "SRS5972243", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00017, null, 2e-05, null, 0.99963, null, 0.75, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55901, "SRR10863042", "SRX7533026", "SRS5972251", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 10dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 10dpf", "imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1", "imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-05_10dpf_PGCs_rep3_S28.R1.fastq.gz", "fastq", 1042531125.0, 13900415.0, "imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1.fastq.gz", "0:75 1:0", "A:256767457;C:264830616;G:280326422;T:240596693;N:9937", 75, 0, null, null, 256767457, 264830616, 280326422, 240596693, 9937, "SRX7533026", "SRS5972251", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 9e-05, null, 3e-05, null, 0.99981, null, 0.55555, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55902, "SRR10863043", "SRX7533025", "SRS5972250", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 10dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 10dpf", "imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1", "imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-04_10dpf_PGCs_rep2_S27.R1.fastq.gz", "fastq", 1011225675.0, 13483009.0, "imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1.fastq.gz", "0:75 1:0", "A:249509861;C:240472285;G:259641490;T:261592569;N:9470", 75, 0, null, null, 249509861, 240472285, 259641490, 261592569, 9470, "SRX7533025", "SRS5972250", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.0001, null, 3e-05, null, 0.99981, null, 0.6, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55903, "SRR10863047", "SRX7533024", "SRS5972249", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 10dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 10dpf", "imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1", "imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-03_10dpf_PGCs_rep1_S26.R1.fastq.gz", "fastq", 1084119750.0, 14454930.0, "imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1.fastq.gz", "0:75 1:0", "A:284983733;C:273119022;G:259385750;T:266620639;N:10606", 75, 0, null, null, 284983733, 273119022, 259385750, 266620639, 10606, "SRX7533024", "SRS5972249", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 7e-05, null, 4e-05, null, 0.99991, null, 1.0, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55904, "SRR10863044", "SRX7533023", "SRS5972248", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 6dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 6dpf", "imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1", "imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_12_57_6dpf_PGCs_rep3_S12.R1.fastq.gz", "fastq", 3431563044.0, 40851941.0, "imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1.fastq.gz", "0:84 1:0", "A:823584243;C:893116880;G:899744072;T:815086020;N:31829", 84, 0, null, null, 823584243, 893116880, 899744072, 815086020, 31829, "SRX7533023", "SRS5972248", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00011, null, 0.0, null, 0.99969, null, 0.7647, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55905, "SRR10863045", "SRX7533022", "SRS5972247", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 6dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 6dpf", "imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1", "imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_11_16_6dpf_PGCs_rep2_S11.R1.fastq.gz", "fastq", 3706743516.0, 44127899.0, "imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1.fastq.gz", "0:84 1:0", "A:934342251;C:847639723;G:983363359;T:941363616;N:34567", 84, 0, null, null, 934342251, 847639723, 983363359, 941363616, 34567, "SRX7533022", "SRS5972247", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00015, null, 1e-05, null, 0.99969, null, 0.79166, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55906, "SRR10863046", "SRX7533021", "SRS5972246", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 6dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 6dpf", "imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1", "imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_10_15_6dpf_PGCs_rep1_S10.R1.fastq.gz", "fastq", 4114543692.0, 48982663.0, "imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1.fastq.gz", "0:84 1:0", "A:993905308;C:987610832;G:993056368;T:1139933198;N:37986", 84, 0, null, null, 993905308, 987610832, 993056368, 1139933198, 37986, "SRX7533021", "SRS5972246", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00012, null, 1e-05, null, 0.99973, null, 0.61111, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55907, "SRR10863048", "SRX7533020", "SRS5972245", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 3dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 3dpf", "imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1", "imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_09_52_3dpf_PGCs_rep3_S9.R1.fastq.gz", "fastq", 3765506136.0, 44827454.0, "imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1.fastq.gz", "0:84 1:0", "A:958464986;C:904515238;G:945479893;T:957010792;N:35227", 84, 0, null, null, 958464986, 904515238, 945479893, 957010792, 35227, "SRX7533020", "SRS5972245", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00026, null, 2e-05, null, 0.99953, null, 0.74418, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55908, "SRR10863049", "SRX7533019", "SRS5972242", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 3dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 3dpf", "imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1", "imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_07_32_3dpf_PGCs_rep1_S7.R1.fastq.gz", "fastq", 3698150988.0, 44025607.0, "imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1.fastq.gz", "0:84 1:0", "A:953164627;C:924016680;G:885078395;T:935856295;N:34991", 84, 0, null, null, 953164627, 924016680, 885078395, 935856295, 34991, "SRX7533019", "SRS5972242", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.0001, null, 1e-05, null, 0.99973, null, 0.57142, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57067, "SRR11214402", "SRX7826914", "SRS6238049", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD18 [miRNA seq]", "GSM4368082", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD18 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368082", "GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368082", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368082", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD18.combined.fastq.gz", "fastq", 702201000.0, 14044020.0, "GSM4368082 r1", "0:50 1:0", "A:165610842;C:167169519;G:192886323;T:176528538;N:5778", 50, 0, null, null, 165610842, 167169519, 192886323, 176528538, 5778, "SRX7826914", "SRS6238049", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.06331, null, 0.00756, null, 0.99153, null, 0.5451, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57068, "SRR11214401", "SRX7826913", "SRS6238048", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD17 [miRNA seq]", "GSM4368081", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD17 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368081", "GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368081", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368081", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD17.combined.fastq.gz", "fastq", 429694400.0, 8593888.0, "GSM4368081 r1", "0:50 1:0", "A:105670449;C:101354858;G:115926173;T:106739304;N:3616", 50, 0, null, null, 105670449, 101354858, 115926173, 106739304, 3616, "SRX7826913", "SRS6238048", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.04686, null, 0.00437, null, 0.99389, null, 0.53154, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57069, "SRR11214400", "SRX7826912", "SRS6238047", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD16 [miRNA seq]", "GSM4368080", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD16 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368080", "GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368080", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368080", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD16.combined.fastq.gz", "fastq", 381826650.0, 7636533.0, "GSM4368080 r1", "0:50 1:0", "A:92578473;C:90665066;G:103254018;T:95325823;N:3270", 50, 0, null, null, 92578473, 90665066, 103254018, 95325823, 3270, "SRX7826912", "SRS6238047", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07185, null, 0.00402, null, 0.99419, null, 0.49823, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57070, "SRR11214399", "SRX7826911", "SRS6238046", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD15 [miRNA seq]", "GSM4368079", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD15 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368079", "GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368079", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368079", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD15.combined.fastq.gz", "fastq", 285535900.0, 5710718.0, "GSM4368079 r1", "0:50 1:0", "A:68624024;C:67839672;G:77291276;T:71778522;N:2406", 50, 0, null, null, 68624024, 67839672, 77291276, 71778522, 2406, "SRX7826911", "SRS6238046", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07651, null, 0.00425, null, 0.99407, null, 0.54635, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57071, "SRR11214398", "SRX7826910", "SRS6238045", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD14 [miRNA seq]", "GSM4368078", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD14 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368078", "GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368078", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368078", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD14.combined.fastq.gz", "fastq", 363231350.0, 7264627.0, "GSM4368078 r1", "0:50 1:0", "A:87298047;C:86511359;G:98123632;T:91295160;N:3152", 50, 0, null, null, 87298047, 86511359, 98123632, 91295160, 3152, "SRX7826910", "SRS6238045", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07156, null, 0.00417, null, 0.99314, null, 0.49982, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57072, "SRR11214397", "SRX7826909", "SRS6238044", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD13 [miRNA seq]", "GSM4368077", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD13 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368077", "GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368077", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368077", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD13.combined.fastq.gz", "fastq", 280852650.0, 5617053.0, "GSM4368077 r1", "0:50 1:0", "A:66976453;C:66985314;G:76111707;T:70776819;N:2357", 50, 0, null, null, 66976453, 66985314, 76111707, 70776819, 2357, "SRX7826909", "SRS6238044", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.0785, null, 0.00403, null, 0.99454, null, 0.53818, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57073, "SRR11214396", "SRX7826908", "SRS6238043", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD12 [miRNA seq]", "GSM4368076", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD12 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368076", "GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368076", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368076", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD12.combined.fastq.gz", "fastq", 267278950.0, 5345579.0, "GSM4368076 r1", "0:50 1:0", "A:63524573;C:63700392;G:72574389;T:67477407;N:2189", 50, 0, null, null, 63524573, 63700392, 72574389, 67477407, 2189, "SRX7826908", "SRS6238043", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.0867, null, 0.00429, null, 0.99403, null, 0.53048, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57074, "SRR11214395", "SRX7826907", "SRS6238042", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD11 [miRNA seq]", "GSM4368075", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD11 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368075", "GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368075", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368075", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD11.combined.fastq.gz", "fastq", 323802250.0, 6476045.0, "GSM4368075 r1", "0:50 1:0", "A:78153815;C:77052322;G:87557986;T:81035226;N:2901", 50, 0, null, null, 78153815, 77052322, 87557986, 81035226, 2901, "SRX7826907", "SRS6238042", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.06809, null, 0.00424, null, 0.99368, null, 0.52229, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57075, "SRR11214394", "SRX7826906", "SRS6238041", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD08 [miRNA seq]", "GSM4368074", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD08 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368074", "GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368074", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368074", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD08.combined.fastq.gz", "fastq", 375132100.0, 7502642.0, "GSM4368074 r1", "0:50 1:0", "A:89764502;C:89300619;G:101501695;T:94562105;N:3179", 50, 0, null, null, 89764502, 89300619, 101501695, 94562105, 3179, "SRX7826906", "SRS6238041", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07787, null, 0.0042, null, 0.99338, null, 0.52599, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57076, "SRR11214393", "SRX7826905", "SRS6238040", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD07 [miRNA seq]", "GSM4368073", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD07 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368073", "GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368073", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368073", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD07.combined.fastq.gz", "fastq", 317528050.0, 6350561.0, "GSM4368073 r1", "0:50 1:0", "A:75643339;C:75642242;G:86133220;T:80106532;N:2717", 50, 0, null, null, 75643339, 75642242, 86133220, 80106532, 2717, "SRX7826905", "SRS6238040", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07711, null, 0.00424, null, 0.9934, null, 0.53196, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57077, "SRR11214392", "SRX7826904", "SRS6238039", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD06 [miRNA seq]", "GSM4368072", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD06 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368072", "GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368072", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368072", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD06.combined.fastq.gz", "fastq", 313235150.0, 6264703.0, "GSM4368072 r1", "0:50 1:0", "A:74970317;C:74745173;G:84767516;T:78749342;N:2802", 50, 0, null, null, 74970317, 74745173, 84767516, 78749342, 2802, "SRX7826904", "SRS6238039", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07206, null, 0.00403, null, 0.99312, null, 0.52846, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57078, "SRR11214391", "SRX7826903", "SRS6238038", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD05 [miRNA seq]", "GSM4368071", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD05 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368071", "GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368071", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368071", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD05.combined.fastq.gz", "fastq", 282608400.0, 5652168.0, "GSM4368071 r1", "0:50 1:0", "A:67639670;C:67139768;G:76678815;T:71147790;N:2357", 50, 0, null, null, 67639670, 67139768, 76678815, 71147790, 2357, "SRX7826903", "SRS6238038", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07587, null, 0.00384, null, 0.99299, null, 0.5434, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57079, "SRR11214390", "SRX7826902", "SRS6238037", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD04 [miRNA seq]", "GSM4368070", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD04 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368070", "GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368070", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368070", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD04.combined.fastq.gz", "fastq", 289767100.0, 5795342.0, "GSM4368070 r1", "0:50 1:0", "A:69580978;C:68900579;G:78340509;T:72942639;N:2395", 50, 0, null, null, 69580978, 68900579, 78340509, 72942639, 2395, "SRX7826902", "SRS6238037", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07492, null, 0.00373, null, 0.99295, null, 0.52294, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57080, "SRR11214389", "SRX7826901", "SRS6238036", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD03 [miRNA seq]", "GSM4368069", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD03 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368069", "GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368069", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368069", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD03.combined.fastq.gz", "fastq", 230982600.0, 4619652.0, "GSM4368069 r1", "0:50 1:0", "A:55200177;C:55003182;G:62615802;T:58161510;N:1929", 50, 0, null, null, 55200177, 55003182, 62615802, 58161510, 1929, "SRX7826901", "SRS6238036", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07179, null, 0.00361, null, 0.99336, null, 0.47352, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57081, "SRR11214388", "SRX7826900", "SRS6238035", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD02 [miRNA seq]", "GSM4368068", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD02 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368068", "GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368068", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368068", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD02.combined.fastq.gz", "fastq", 367984500.0, 7359690.0, "GSM4368068 r1", "0:50 1:0", "A:87859797;C:87548819;G:99752643;T:92820007;N:3234", 50, 0, null, null, 87859797, 87548819, 99752643, 92820007, 3234, "SRX7826900", "SRS6238035", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07619, null, 0.00398, null, 0.99403, null, 0.53717, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57082, "SRR11214387", "SRX7826899", "SRS6238034", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD01 [miRNA seq]", "GSM4368067", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD01 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368067", "GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368067", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368067", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD01.combined.fastq.gz", "fastq", 374941900.0, 7498838.0, "GSM4368067 r1", "0:50 1:0", "A:90013932;C:89307034;G:101275933;T:94341753;N:3248", 50, 0, null, null, 90013932, 89307034, 101275933, 94341753, 3248, "SRX7826899", "SRS6238034", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07456, null, 0.00386, null, 0.99399, null, 0.52664, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57144, "SRR11218074", "SRX7830305", "SRS6240984", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 8PY", "GSM4369117", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 8PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369117", "GSM4369117: SS 8PY; Danio rerio; ncRNA Seq", "GSM4369117", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369117", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.8_PYR.fq.gz", "fastq", 957995832.0, 18784232.0, "GSM4369117 r1", "0:51 1:0", "A:228507696;C:213417776;G:258943243;T:257032661;N:94456", 51, 0, null, null, 228507696, 213417776, 258943243, 257032661, 94456, "SRX7830305", "SRS6240984", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.60772, null, 0.1313, null, 0.9877, null, 0.5307, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57145, "SRR11218073", "SRX7830304", "SRS6240983", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 8IN", "GSM4369116", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 8IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369116", "GSM4369116: SS 8IN; Danio rerio; ncRNA Seq", "GSM4369116", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369116", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.8_INH.fq.gz", "fastq", 469965.0, 9215.0, "GSM4369116 r1", "0:51 1:0", "A:115943;C:105774;G:126829;T:121280;N:139", 51, 0, null, null, 115943, 105774, 126829, 121280, 139, "SRX7830304", "SRS6240983", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.63582, null, 0.11966, null, 0.99628, null, 0.52244, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57146, "SRR11218072", "SRX7830303", "SRS6240982", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 8Co", "GSM4369115", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 8Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369115", "GSM4369115: SS 8Co; Danio rerio; ncRNA Seq", "GSM4369115", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369115", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.8_Control.fq.gz", "fastq", 1016301786.0, 19927486.0, "GSM4369115 r1", "0:51 1:0", "A:234047138;C:231668317;G:283673780;T:266812487;N:100064", 51, 0, null, null, 234047138, 231668317, 283673780, 266812487, 100064, "SRX7830303", "SRS6240982", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.45617, null, 0.08006, null, 0.98756, null, 0.53318, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57147, "SRR11218071", "SRX7830302", "SRS6240981", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 7PY", "GSM4369114", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 7PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369114", "GSM4369114: SS 7PY; Danio rerio; ncRNA Seq", "GSM4369114", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369114", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.7_PYR.fq.gz", "fastq", 994662945.0, 19503195.0, "GSM4369114 r1", "0:51 1:0", "A:238913864;C:226034038;G:265449938;T:264166944;N:98161", 51, 0, null, null, 238913864, 226034038, 265449938, 264166944, 98161, "SRX7830302", "SRS6240981", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.72706, null, 0.14266, null, 0.98796, null, 0.45475, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57148, "SRR11218070", "SRX7830301", "SRS6240980", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 7IN", "GSM4369113", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 7IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369113", "GSM4369113: SS 7IN; Danio rerio; ncRNA Seq", "GSM4369113", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369113", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.7_INH.fq.gz", "fastq", 698866770.0, 13703270.0, "GSM4369113 r1", "0:51 1:0", "A:163946545;C:151571623;G:188671555;T:194609709;N:67338", 51, 0, null, null, 163946545, 151571623, 188671555, 194609709, 67338, "SRX7830301", "SRS6240980", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.5089, null, 0.12515, null, 0.98636, null, 0.5449, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57149, "SRR11218069", "SRX7830300", "SRS6240979", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 7Co", "GSM4369112", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 7Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369112", "GSM4369112: SS 7Co; Danio rerio; ncRNA Seq", "GSM4369112", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369112", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.7_Control.fq.gz", "fastq", 675141111.0, 13238061.0, "GSM4369112 r1", "0:51 1:0", "A:158015253;C:144827125;G:185064213;T:187168263;N:66257", 51, 0, null, null, 158015253, 144827125, 185064213, 187168263, 66257, "SRX7830300", "SRS6240979", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.40459, null, 0.10193, null, 0.98723, null, 0.50939, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57150, "SRR11218068", "SRX7830299", "SRS6240978", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 6PY", "GSM4369111", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 6PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369111", "GSM4369111: SS 6PY; Danio rerio; ncRNA Seq", "GSM4369111", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369111", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.6_PYR.fq.gz", "fastq", 750671142.0, 14719042.0, "GSM4369111 r1", "0:51 1:0", "A:179604494;C:169819225;G:201679305;T:199493837;N:74281", 51, 0, null, null, 179604494, 169819225, 201679305, 199493837, 74281, "SRX7830299", "SRS6240978", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.6831, null, 0.13287, null, 0.98739, null, 0.53779, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57151, "SRR11218067", "SRX7830298", "SRS6240977", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 6IN", "GSM4369110", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 6IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369110", "GSM4369110: SS 6IN; Danio rerio; ncRNA Seq", "GSM4369110", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369110", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.6_INH.fq.gz", "fastq", 665736915.0, 13053665.0, "GSM4369110 r1", "0:51 1:0", "A:157656775;C:147244006;G:178619094;T:182150634;N:66406", 51, 0, null, null, 157656775, 147244006, 178619094, 182150634, 66406, "SRX7830298", "SRS6240977", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.5998, null, 0.13571, null, 0.9867, null, 0.50064, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57152, "SRR11218066", "SRX7830297", "SRS6240976", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 6Co", "GSM4369109", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 6Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369109", "GSM4369109: SS 6Co; Danio rerio; ncRNA Seq", "GSM4369109", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369109", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.6_Control.fq.gz", "fastq", 615356565.0, 12065815.0, "GSM4369109 r1", "0:51 1:0", "A:145586024;C:131520739;G:167413237;T:170777582;N:58983", 51, 0, null, null, 145586024, 131520739, 167413237, 170777582, 58983, "SRX7830297", "SRS6240976", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.43246, null, 0.11481, null, 0.98721, null, 0.51875, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57153, "SRR11218065", "SRX7830296", "SRS6240975", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 5PY", "GSM4369108", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 5PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369108", "GSM4369108: SS 5PY; Danio rerio; ncRNA Seq", "GSM4369108", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369108", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.5_PYR.fq.gz", "fastq", 765220677.0, 15004327.0, "GSM4369108 r1", "0:51 1:0", "A:184664309;C:170899633;G:204508602;T:205072262;N:75871", 51, 0, null, null, 184664309, 170899633, 204508602, 205072262, 75871, "SRX7830296", "SRS6240975", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.68375, null, 0.14802, null, 0.98819, null, 0.54732, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57154, "SRR11218064", "SRX7830295", "SRS6240974", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 5IN", "GSM4369107", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 5IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369107", "GSM4369107: SS 5IN; Danio rerio; ncRNA Seq", "GSM4369107", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369107", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.5_INH.fq.gz", "fastq", 814440114.0, 15969414.0, "GSM4369107 r1", "0:51 1:0", "A:190771507;C:181466379;G:220318895;T:221802003;N:81330", 51, 0, null, null, 190771507, 181466379, 220318895, 221802003, 81330, "SRX7830295", "SRS6240974", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.58304, null, 0.11681, null, 0.98725, null, 0.53607, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57155, "SRR11218063", "SRX7830294", "SRS6240973", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 5Co", "GSM4369106", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 5Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369106", "GSM4369106: SS 5Co; Danio rerio; ncRNA Seq", "GSM4369106", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369106", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.5_Control.fq.gz", "fastq", 677415660.0, 13282660.0, "GSM4369106 r1", "0:51 1:0", "A:159925012;C:146760884;G:184475935;T:186186960;N:66869", 51, 0, null, null, 159925012, 146760884, 184475935, 186186960, 66869, "SRX7830294", "SRS6240973", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.48645, null, 0.11412, null, 0.98701, null, 0.5051, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57156, "SRR11218062", "SRX7830293", "SRS6240972", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 4PY", "GSM4369105", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 4PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369105", "GSM4369105: SS 4PY; Danio rerio; ncRNA Seq", "GSM4369105", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369105", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.4_PYR.fq.gz", "fastq", 708855120.0, 13899120.0, "GSM4369105 r1", "0:51 1:0", "A:166247754;C:166449883;G:193535378;T:182549405;N:72700", 51, 0, null, null, 166247754, 166449883, 193535378, 182549405, 72700, "SRX7830293", "SRS6240972", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.71998, null, 0.10284, null, 0.9865, null, 0.51364, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57157, "SRR11218061", "SRX7830292", "SRS6240971", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 4IN", "GSM4369104", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 4IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369104", "GSM4369104: SS 4IN; Danio rerio; ncRNA Seq", "GSM4369104", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369104", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.4_INH.fq.gz", "fastq", 1113750597.0, 21838247.0, "GSM4369104 r1", "0:51 1:0", "A:258675243;C:241304435;G:306760462;T:306899964;N:110493", 51, 0, null, null, 258675243, 241304435, 306760462, 306899964, 110493, "SRX7830292", "SRS6240971", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.38867, null, 0.10253, null, 0.98739, null, 0.54594, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57158, "SRR11218060", "SRX7830291", "SRS6240970", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 4Co", "GSM4369103", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 4Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369103", "GSM4369103: SS 4Co; Danio rerio; ncRNA Seq", "GSM4369103", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369103", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.4_Control.fq.gz", "fastq", 837457944.0, 16420744.0, "GSM4369103 r1", "0:51 1:0", "A:194913060;C:201962625;G:234236177;T:206260303;N:85779", 51, 0, null, null, 194913060, 201962625, 234236177, 206260303, 85779, "SRX7830291", "SRS6240970", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.78427, null, 0.07281, null, 0.98938, null, 0.51853, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57159, "SRR11218059", "SRX7830290", "SRS6240969", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 3PY", "GSM4369102", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 3PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369102", "GSM4369102: SS 3PY; Danio rerio; ncRNA Seq", "GSM4369102", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369102", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.3_PYR.fq.gz", "fastq", 760961157.0, 14920807.0, "GSM4369102 r1", "0:51 1:0", "A:180329733;C:162762377;G:203401780;T:214391898;N:75369", 51, 0, null, null, 180329733, 162762377, 203401780, 214391898, 75369, "SRX7830290", "SRS6240969", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.52001, null, 0.13578, null, 0.98721, null, 0.54044, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57160, "SRR11218058", "SRX7830289", "SRS6240968", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 3IN", "GSM4369101", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 3IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369101", "GSM4369101: SS 3IN; Danio rerio; ncRNA Seq", "GSM4369101", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369101", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.3_INH.fq.gz", "fastq", 1018682364.0, 19974164.0, "GSM4369101 r1", "0:51 1:0", "A:234817384;C:219512001;G:281378236;T:282876741;N:98002", 51, 0, null, null, 234817384, 219512001, 281378236, 282876741, 98002, "SRX7830289", "SRS6240968", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.35713, null, 0.09659, null, 0.98642, null, 0.48819, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57161, "SRR11218057", "SRX7830288", "SRS6240967", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 3Co", "GSM4369100", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 3Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369100", "GSM4369100: SS 3Co; Danio rerio; ncRNA Seq", "GSM4369100", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369100", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.3_Control.fq.gz", "fastq", 801765339.0, 15720889.0, "GSM4369100 r1", "0:51 1:0", "A:188213764;C:176265401;G:220274116;T:216937235;N:74823", 51, 0, null, null, 188213764, 176265401, 220274116, 216937235, 74823, "SRX7830288", "SRS6240967", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.49039, null, 0.09948, null, 0.98794, null, 0.53195, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57162, "SRR11218056", "SRX7830287", "SRS6240966", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 2PY", "GSM4369099", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 2PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369099", "GSM4369099: SS 2PY; Danio rerio; ncRNA Seq", "GSM4369099", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369099", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.2_PYR.fq.gz", "fastq", 574313805.0, 11261055.0, "GSM4369099 r1", "0:51 1:0", "A:135292244;C:131200630;G:155228609;T:152535200;N:57122", 51, 0, null, null, 135292244, 131200630, 155228609, 152535200, 57122, "SRX7830287", "SRS6240966", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.66365, null, 0.11507, null, 0.98687, null, 0.51107, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57163, "SRR11218055", "SRX7830286", "SRS6240965", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 2IN", "GSM4369098", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 2IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369098", "GSM4369098: SS 2IN; Danio rerio; ncRNA Seq", "GSM4369098", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369098", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.2_INH.fq.gz", "fastq", 807418230.0, 15831730.0, "GSM4369098 r1", "0:51 1:0", "A:190588465;C:176108754;G:219052662;T:221586329;N:82020", 51, 0, null, null, 190588465, 176108754, 219052662, 221586329, 82020, "SRX7830286", "SRS6240965", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.47844, null, 0.10981, null, 0.98723, null, 0.54721, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57164, "SRR11218054", "SRX7830285", "SRS6240964", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 2Co", "GSM4369097", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 2Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369097", "GSM4369097: SS 2Co; Danio rerio; ncRNA Seq", "GSM4369097", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369097", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.2_Control.fq.gz", "fastq", 932774037.0, 18289687.0, "GSM4369097 r1", "0:51 1:0", "A:218099260;C:200897948;G:257769791;T:255915444;N:91594", 51, 0, null, null, 218099260, 200897948, 257769791, 255915444, 91594, "SRX7830285", "SRS6240964", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.42164, null, 0.09363, null, 0.98746, null, 0.53483, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57165, "SRR11218053", "SRX7830284", "SRS6240963", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 1PY", "GSM4369096", null, "tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "SS 1PY", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "PYR 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA", "GSM4369096", "GSM4369096: SS 1PY; Danio rerio; ncRNA Seq", "GSM4369096", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369096", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.1_PYR.fq.gz", "fastq", 616504422.0, 12088322.0, "GSM4369096 r1", "0:51 1:0", "A:145443705;C:140693898;G:166974890;T:163330321;N:61608", 51, 0, null, null, 145443705, 140693898, 166974890, 163330321, 61608, "SRX7830284", "SRS6240963", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.65536, null, 0.11483, null, 0.9867, null, 0.53016, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57166, "SRR11218052", "SRX7830283", "SRS6240962", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 1IN", "GSM4369095", null, "tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "SS 1IN", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "INH 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA", "GSM4369095", "GSM4369095: SS 1IN; Danio rerio; ncRNA Seq", "GSM4369095", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369095", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.1_INH.fq.gz", "fastq", 837218142.0, 16416042.0, "GSM4369095 r1", "0:51 1:0", "A:194291608;C:181525851;G:230886112;T:230433107;N:81464", 51, 0, null, null, 194291608, 181525851, 230886112, 230433107, 81464, "SRX7830283", "SRS6240962", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.41653, null, 0.09487, null, 0.9877, null, 0.54467, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"], [57167, "SRR11218051", "SRX7830282", "SRS6240961", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 1Co", "GSM4369094", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 1Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b \"GTTCAGAGTTCTACAGTCCGACGATC\" b \"TGGAATTCTCGGGTGCCAAGG\" b \"GATCGTCGGACTGTAGAACTCTGAAC\" b \"CCTTGGCACCCGAGAATTCCA\" O 6 m 17 \u2013format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369094", "GSM4369094: SS 1Co; Danio rerio; ncRNA Seq", "GSM4369094", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369094", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.1_Control.fq.gz", "fastq", 346638432.0, 6796832.0, "GSM4369094 r1", "0:51 1:0", "A:80463778;C:81241478;G:96669917;T:88228518;N:34741", 51, 0, null, null, 80463778, 81241478, 96669917, 88228518, 34741, "SRX7830282", "SRS6240961", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.66922, null, 0.07698, null, 0.98829, null, 0.52033, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"]], "truncated": false, "filtered_table_rows_count": 66, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"experiment.library_strategy\" = :p1 order by rowid limit 101", "params": {"p0": "Larval", "p1": "ncRNA-Seq"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 66, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 66, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "size fractionation", "label": "size fractionation", "count": 66, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 66, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Larval", "label": "Larval", "count": 66, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&devstage_curation_coarse=Larval", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Larval", "label": "Larval", "count": 66, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 32, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=Undetermined", "selected": false}, {"value": "All anatomical structures", "label": "All anatomical structures", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "selected": false}, {"value": "Liver and Biliary System", "label": "Liver and Biliary System", "count": 5, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=Liver+and+Biliary+System", "selected": false}, {"value": "Surface Structure", "label": "Surface Structure", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=Surface+Structure", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 32, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation=Undetermined", "selected": false}, {"value": "Whole Organism", "label": "Whole Organism", "count": 25, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation=Whole+Organism", "selected": false}, {"value": "Liver", "label": "Liver", "count": 5, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation=Liver", "selected": false}, {"value": "Trunk", "label": "Trunk", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation=Trunk", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&tissue_curation=Embryo+Imprecise", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "unknown", "label": "unknown", "count": 50, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Larval&experiment.library_strategy=ncRNA-Seq&technology=bulk", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 100.27155998977832}