{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Blastula\" and tissue_curation = \"Embryo Imprecise\"", "rows": [[8089, "ERR034126", "ERX012652", "ERS032267", "ERP000635", "PRJEB2512", "The Zebrafish transcriptome during early development", "KI-BN-JKE-DRERIO-RNASEQ-2011", "Transcriptome Analysis", "Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65%   73% reads were successfully mapped to the zebrafish genome and 36%   44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding  protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results  and to further investigate the developmental expression of specific genes  the transcript levels of a subset of genes were analyzed using TaqMan\u00ae array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels  with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes  whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes  number of uniquely expressed genes and enrichment of GO molecular functions.", null, null, "RNA extracted from zebrafish embryo at 512 cell stage", "zebrafish embryo 512 cell", "SAMEA791632", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", "ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791632|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition  Karolinska Institutet  Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 512cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 512cell|sex:mixed|strain:Tuebingen", null, null, null, null, null, null, null, null, "Transcriptome profiling of early zebrafish development", "KI BN JKE DRERIO RNASEQ 2011 512cell", "JKE Drerio rna seq", "Transcriptome profiling of 512 cell stage of zebrafish embryos.", "Total RNA was extracted from approximately 150 embryos                     per developmental stage using Trireagent                     Sigma Aldrich. The total RNA was then processed                     further according to the Small RNA Expression Kit                     Applied Biosystems.", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ABI_SOLID", "AB SOLiD System 3.0", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "ERP000635", "AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development", "ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16", "KI-BN-JKE-DRERIO-RNASEQ-2011-512cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-512cell_QV.qual.gz", "SOLiD_native SOLiD_native", 3918756250.0, 78375125.0, "KI BN JKE DRERIO RNASEQ 2011 512cell", "0:50", null, 50, null, null, null, null, null, null, null, null, "ERX012652", "ERS032267", "ERA029959", "KI-BN|Department of Biosciences and Nutrition", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", 1, 0.63824, null, 0.09111, null, 0.91969, null, 0.73496, null, 50, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Sweden", "2011-06-09", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [11041, "ERR9995536", "ERX9536682", "ERS12521224", "ERP138294", "PRJEB53494", "Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing", "94bf5509-4622-4d5f-b7c5-6a14bdfac340", "Other", "RNA polyadenylation plays a central role in RNA maturation  fate  and stability. In response to developmental cues  polyA tail lengths can vary  affecting the translation efficiency and stability of mRNAs. Here  we develop Nanopore three prime end capture sequencing Nano3P seq  a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance  tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol  Nano3P seq can sequence any given RNA molecule from its three prime end  regardless of its polyadenylation status  without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes  providing quantitative estimates of RNA abundance and tail lengths in mRNA  lncRNA  sn/snoRNA  scaRNA  and rRNA molecules. We find that  in addition to mRNA and lncRNA  polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover  we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level  correlating with mRNA decay. Finally  we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis.  Overall  Nano3P seq is a simple and robust method for accurately estimating transcript levels  tail lengths  and tail composition heterogeneity in individual reads  with minimal library preparation biases  both in the coding and non coding transcriptome.", "ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10", null, "dRNA seq of 4hpf Zebrafish embryos", "Zebrafish dRNA 4hpf", "SAMEA110422854", "CENTER FOR GENOMIC REGULATION (CRG)", "ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110422854|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:21:01Z|INSDC last update:2022 10 10T00:21:01Z|INSDC status:public|Submitter Id:Zebrafish dRNA 4hpf|common name:zebrafish|sample name:Zebrafish dRNA 4hpf", null, null, null, null, null, null, null, null, "MinION sequencing", "ena EXPERIMENT TAB 27 07 2022 11:41:43:673 3", "Zebrafish dRNA 4hpf", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "OXFORD_NANOPORE", "MinION", null, "ERP138294", "MinION sequencing", "ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|instrument model:PromethION", "PDBN042841_dRNA_4hpf.tar.gz", "nanopore", 772304625.0, 897768.0, "ena RUN TAB 27 07 2022 11:41:43:690 4", "0:860.25", "A:224977035;C:165273397;G:156659356;T:225394837;N:0", 860, null, null, null, 224977035, 165273397, 156659356, 225394837, 0, "ERX9536682", "ERS12521224", "ERA16500713", "CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive", "CENTER FOR GENOMIC REGULATION (CRG)", null, null, null, null, null, null, null, null, null, null, null, null, null, null, "ont", "ont", "3prime", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-10-10", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28539, "SRR26395013", "SRX22100921", "SRS19166047", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "zfs:0000015 Iso seq", null, "strain:AB x India|age:4.7 hpf|dev stage:zfs:0000015|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 9|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: zfs:0000015", "DR 009", "DR 009", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "30epiboly.ccs.fq.gz", "fastq", 5233736965.0, 1358516.0, "zfs:0000015.ccs.fq.gz", "0:3852.54", "A:1425421240;C:1199630062;G:1191034759;T:1417650904;N:0", 3852, null, null, null, 1425421240, 1199630062, 1191034759, 1417650904, 0, "SRX22100921", "SRS19166047", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.40862, null, 0.00581, null, 0.86123, null, 0.47684, null, 3440, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28540, "SRR26395014", "SRX22100920", "SRS19166046", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "dome Iso seq", null, "strain:AB x India|age:4.3 hpf|dev stage:dome|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 8|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: dome", "DR 008", "DR 008", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "dome.ccs.fq.gz", "fastq", 6426069602.0, 1667809.0, "dome.ccs.fq.gz", "0:3853.00", "A:1735630855;C:1486999783;G:1476424228;T:1727014736;N:0", 3853, null, null, null, 1735630855, 1486999783, 1476424228, 1727014736, 0, "SRX22100920", "SRS19166046", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.20197, null, 0.00145, null, 0.91388, null, 0.06247, null, 6938, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28541, "SRR26395015", "SRX22100919", "SRS19166045", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "sphere Iso seq", null, "strain:AB x India|age:4 hpf|dev stage:sphere|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 7|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: sphere", "DR 007", "DR 007", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "sphere.ccs.fq.gz", "fastq", 7456522395.0, 2030744.0, "sphere.ccs.fq.gz", "0:3671.82", "A:2009379061;C:1725915606;G:1718055774;T:2003171954;N:0", 3671, null, null, null, 2009379061, 1725915606, 1718055774, 2003171954, 0, "SRX22100919", "SRS19166045", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.41317, null, 0.00317, null, 0.85504, null, 0.46671, null, 5517, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28543, "SRR26395017", "SRX22100916", "SRS19166042", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "oblong Iso seq", null, "strain:AB x India|age:3.7 hpf|dev stage:oblong|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: oblong", "DR 006", "DR 006", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "oblong.ccs.fq.gz", "fastq", 5138806264.0, 1450821.0, "oblong.ccs.fq.gz", "0:3542.00", "A:1387179645;C:1186984765;G:1181776562;T:1382865292;N:0", 3542, null, null, null, 1387179645, 1186984765, 1181776562, 1382865292, 0, "SRX22100916", "SRS19166042", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.41494, null, 0.0019, null, 0.85267, null, 0.45513, null, 8789, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28551, "SRR26395025", "SRX22100908", "SRS19166036", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep8", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 8|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate8", "DR 043", "DR 043", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-8_1.fq.gz C1K-8_2.fq.gz", "fastq fastq", 17897176360.0, 63918487.0, "C1K 8 1.fq.gz", "0:140 1:140", "A:4746019128;C:4222117801;G:4262745510;T:4666241121;N:52800", 140, 140, null, null, 4746019128, 4222117801, 4262745510, 4666241121, 52800, "SRX22100908", "SRS19166036", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95626, 0.95754, 0.02383, 0.02273, 0.76155, 0.76116, 0.47882, 0.47576, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28552, "SRR26395026", "SRX22100907", "SRS19166033", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep7", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 7|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate7", "DR 042", "DR 042", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-7_1.fq.gz C1K-7_2.fq.gz", "fastq fastq", 18354684880.0, 65552446.0, "C1K 7 1.fq.gz", "0:140 1:140", "A:4895158722;C:4306679638;G:4342135666;T:4810655169;N:55685", 140, 140, null, null, 4895158722, 4306679638, 4342135666, 4810655169, 55685, "SRX22100907", "SRS19166033", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95303, 0.95677, 0.02498, 0.02373, 0.75893, 0.75866, 0.47717, 0.47879, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28553, "SRR26395027", "SRX22100906", "SRS19166032", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep6", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate6", "DR 041", "DR 041", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-6_1.fq.gz C1K-6_2.fq.gz", "fastq fastq", 19129533360.0, 68319762.0, "C1K 6 1.fq.gz", "0:140 1:140", "A:5092659624;C:4497887725;G:4535246152;T:5003683373;N:56486", 140, 140, null, null, 5092659624, 4497887725, 4535246152, 5003683373, 56486, "SRX22100906", "SRS19166032", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95423, 0.95605, 0.02565, 0.0242, 0.76086, 0.76108, 0.47814, 0.47811, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28554, "SRR26395028", "SRX22100905", "SRS19166031", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "high Iso seq", null, "strain:AB x India|age:3.3 hpf|dev stage:high|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: high", "DR 005", "DR 005", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "high.ccs.fq.gz", "fastq", 6811221417.0, 1785766.0, "high.ccs.fq.gz", "0:3814.17", "A:1820349159;C:1592171013;G:1583702800;T:1814998445;N:0", 3814, null, null, null, 1820349159, 1592171013, 1583702800, 1814998445, 0, "SRX22100905", "SRS19166031", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.42981, null, 0.00073, null, 0.86182, null, 0.47846, null, 4404, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28555, "SRR26395029", "SRX22100904", "SRS19166030", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep5", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate5", "DR 040", "DR 040", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-5_1.fq.gz C1K-5_2.fq.gz", "fastq fastq", 15372822080.0, 54902936.0, "C1K 5 1.fq.gz", "0:140 1:140", "A:4098626531;C:3607276129;G:3638280102;T:4028593737;N:45581", 140, 140, null, null, 4098626531, 3607276129, 3638280102, 4028593737, 45581, "SRX22100904", "SRS19166030", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95392, 0.95707, 0.02512, 0.02391, 0.75921, 0.75935, 0.4795, 0.47195, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28556, "SRR26395030", "SRX22100903", "SRS19166029", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep4", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate4", "DR 039", "DR 039", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-4_1.fq.gz C1K-4_2.fq.gz", "fastq fastq", 20077595440.0, 71705698.0, "C1K 4 1.fq.gz", "0:140 1:140", "A:5379901813;C:4687577466;G:4725766166;T:5284289042;N:60953", 140, 140, null, null, 5379901813, 4687577466, 4725766166, 5284289042, 60953, "SRX22100903", "SRS19166029", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95148, 0.95674, 0.02629, 0.02499, 0.76163, 0.76155, 0.48018, 0.47955, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28557, "SRR26395031", "SRX22100902", "SRS19166028", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep3", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate3", "DR 038", "DR 038", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-3_1.fq.gz C1K-3_2.fq.gz", "fastq fastq", 17934590800.0, 64052110.0, "C1K 3 1.fq.gz", "0:140 1:140", "A:4787436112;C:4203684173;G:4237881984;T:4705533453;N:55078", 140, 140, null, null, 4787436112, 4203684173, 4237881984, 4705533453, 55078, "SRX22100902", "SRS19166028", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95381, 0.95598, 0.03203, 0.03053, 0.75586, 0.75475, 0.48144, 0.48324, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28558, "SRR26395032", "SRX22100901", "SRS19166027", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep2", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate2", "DR 037", "DR 037", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-2_2.fq.gz C1K-2_1.fq.gz", "fastq fastq", 19274856720.0, 68838774.0, "C1K 2 1.fq.gz", "0:140 1:140", "A:5184052449;C:4482949893;G:4518818272;T:5088977570;N:58536", 140, 140, null, null, 5184052449, 4482949893, 4518818272, 5088977570, 58536, "SRX22100901", "SRS19166027", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.95024, 0.95418, 0.02706, 0.02563, 0.76159, 0.7615, 0.47685, 0.47835, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28559, "SRR26395033", "SRX22100900", "SRS19166026", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell RNA seq rep1", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 1k 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Illumina RNA seq of zebrafish: 1k cell replicate1", "DR 036", "DR 036", "mRNA from five stages fertilized egg  1 cell  64 cell  1k cell  and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB  USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP466518", null, null, "C1K-1_1.fq.gz C1K-1_2.fq.gz", "fastq fastq", 16722160840.0, 59722003.0, "C1K 1 1.fq.gz", "0:140 1:140", "A:4499833873;C:3886448032;G:3916224310;T:4419604469;N:50156", 140, 140, null, null, 4499833873, 3886448032, 3916224310, 4419604469, 50156, "SRX22100900", "SRS19166026", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 2, 0.94949, 0.95361, 0.02676, 0.0253, 0.76343, 0.76313, 0.48343, 0.47901, 140, 140, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28565, "SRR26395039", "SRX22100894", "SRS19166020", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell Iso seq", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: 1k cell", "DR 004", "DR 004", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "1k.ccs.fq.gz", "fastq", 8036121763.0, 2087907.0, "1k.ccs.fq.gz", "0:3848.89", "A:2152838341;C:1873567602;G:1863627936;T:2146087884;N:0", 3848, null, null, null, 2152838341, 1873567602, 1863627936, 2146087884, 0, "SRX22100894", "SRS19166020", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.43117, null, 0.00077, null, 0.86352, null, 0.48891, null, 2071, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28622, "SRR26502012", "SRX22205866", "SRS19261274", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "U 30 C", "GSM7863856", null, "tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "U 30 C", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:uninjected U controls|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863856", "GSM7863856: U 30 C; Danio rerio; RNA Seq", "GSM7863856 r1", "GSM7863856", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "U_30_C_1.fq.gz U_30_C_2.fq.gz", "fastq fastq", 7905179100.0, 26350597.0, "GSM7863856 r1", "0:150 1:150", "A:2112538655;C:1849914542;G:1854205071;T:2088453319;N:67513", 150, 150, null, null, 2112538655, 1849914542, 1854205071, 2088453319, 67513, "SRX22205866", "SRS19261274", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96286, 0.96328, 0.06542, 0.06513, 0.73943, 0.74093, 0.48278, 0.48511, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28623, "SRR26502013", "SRX22205865", "SRS19261272", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "U 30 B", "GSM7863855", null, "tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "U 30 B", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:uninjected U controls|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863855", "GSM7863855: U 30 B; Danio rerio; RNA Seq", "GSM7863855 r1", "GSM7863855", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "U_30_B_2.fq.gz U_30_B_1.fq.gz", "fastq fastq", 6650731800.0, 22169106.0, "GSM7863855 r1", "0:150 1:150", "A:1777471388;C:1556330544;G:1562695999;T:1754177827;N:56042", 150, 150, null, null, 1777471388, 1556330544, 1562695999, 1754177827, 56042, "SRX22205865", "SRS19261272", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96329, 0.96339, 0.06295, 0.06318, 0.74442, 0.74572, 0.48629, 0.48653, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28624, "SRR26502014", "SRX22205864", "SRS19261271", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "U 30 A", "GSM7863854", null, "tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "U 30 A", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:uninjected U controls|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863854", "GSM7863854: U 30 A; Danio rerio; RNA Seq", "GSM7863854 r1", "GSM7863854", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "U_30_A_1.fq.gz U_30_A_2.fq.gz", "fastq fastq", 7437077400.0, 24790258.0, "GSM7863854 r1", "0:150 1:150", "A:1985983578;C:1744359981;G:1745773559;T:1960900148;N:60134", 150, 150, null, null, 1985983578, 1744359981, 1745773559, 1960900148, 60134, "SRX22205864", "SRS19261271", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.95673, 0.96426, 0.06942, 0.0698, 0.74533, 0.74523, 0.47204, 0.47093, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28628, "SRR26502018", "SRX22205860", "SRS19261268", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "T SR C", "GSM7863850", null, "tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "T SR C", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:sphere SR|approx time hpf index:1", "GSM7863850", "GSM7863850: T SR C; Danio rerio; RNA Seq", "GSM7863850 r1", "GSM7863850", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "T_SR_C_1.fq.gz T_SR_C_2.fq.gz", "fastq fastq", 7320993000.0, 24403310.0, "GSM7863850 r1", "0:150 1:150", "A:1940469413;C:1728327642;G:1734944847;T:1917189057;N:62041", 150, 150, null, null, 1940469413, 1728327642, 1734944847, 1917189057, 62041, "SRX22205860", "SRS19261268", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96725, 0.9678, 0.04118, 0.0405, 0.75089, 0.7516, 0.47804, 0.47902, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28629, "SRR26502019", "SRX22205859", "SRS19261266", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "T SR B", "GSM7863849", null, "tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "T SR B", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:sphere SR|approx time hpf index:1", "GSM7863849", "GSM7863849: T SR B; Danio rerio; RNA Seq", "GSM7863849 r1", "GSM7863849", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "T_SR_B_1.fq.gz T_SR_B_2.fq.gz", "fastq fastq", 5614698000.0, 18715660.0, "GSM7863849 r1", "0:150 1:150", "A:1490636335;C:1323289375;G:1325815454;T:1474908119;N:48717", 150, 150, null, null, 1490636335, 1323289375, 1325815454, 1474908119, 48717, "SRX22205859", "SRS19261266", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96732, 0.9666, 0.04814, 0.04742, 0.746, 0.74692, 0.48039, 0.48012, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28630, "SRR26502020", "SRX22205858", "SRS19261267", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "T SR A", "GSM7863848", null, "tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "T SR A", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:sphere SR|approx time hpf index:1", "GSM7863848", "GSM7863848: T SR A; Danio rerio; RNA Seq", "GSM7863848 r1", "GSM7863848", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "T_SR_A_1.fq.gz T_SR_A_2.fq.gz", "fastq fastq", 6573058800.0, 21910196.0, "GSM7863848 r1", "0:150 1:150", "A:1739848105;C:1550749449;G:1560476524;T:1721929364;N:55358", 150, 150, null, null, 1739848105, 1550749449, 1560476524, 1721929364, 55358, "SRX22205858", "SRS19261267", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96683, 0.96701, 0.04223, 0.04172, 0.74811, 0.74752, 0.48523, 0.48376, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28643, "SRR26502033", "SRX22205845", "SRS19261253", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "U SR C", "GSM7863871", null, "tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "U SR C", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:uninjected U controls|developmental stage:sphere SR|approx time hpf index:1", "GSM7863871", "GSM7863871: U SR C; Danio rerio; RNA Seq", "GSM7863871 r1", "GSM7863871", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "U_SR_C_1.fq.gz U_SR_C_2.fq.gz", "fastq fastq", 6618044100.0, 22060147.0, "GSM7863871 r1", "0:150 1:150", "A:1747883351;C:1567618988;G:1571605745;T:1730878670;N:57346", 150, 150, null, null, 1747883351, 1567618988, 1571605745, 1730878670, 57346, "SRX22205845", "SRS19261253", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.9666, 0.967, 0.03749, 0.0375, 0.75049, 0.75122, 0.47751, 0.47569, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28644, "SRR26502034", "SRX22205844", "SRS19261252", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "U SR B", "GSM7863870", null, "tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "U SR B", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:uninjected U controls|developmental stage:sphere SR|approx time hpf index:1", "GSM7863870", "GSM7863870: U SR B; Danio rerio; RNA Seq", "GSM7863870 r1", "GSM7863870", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "U_SR_B_1.fq.gz U_SR_B_2.fq.gz", "fastq fastq", 7066620300.0, 23555401.0, "GSM7863870 r1", "0:150 1:150", "A:1904313513;C:1637643233;G:1639843500;T:1884759281;N:60773", 150, 150, null, null, 1904313513, 1637643233, 1639843500, 1884759281, 60773, "SRX22205844", "SRS19261252", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96457, 0.96422, 0.05314, 0.0529, 0.74495, 0.74598, 0.48308, 0.48562, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28645, "SRR26502035", "SRX22205843", "SRS19261251", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "U SR A", "GSM7863869", null, "tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "U SR A", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:uninjected U controls|developmental stage:sphere SR|approx time hpf index:1", "GSM7863869", "GSM7863869: U SR A; Danio rerio; RNA Seq", "GSM7863869 r1", "GSM7863869", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "U_SR_A_1.fq.gz U_SR_A_2.fq.gz", "fastq fastq", 6739457700.0, 22464859.0, "GSM7863869 r1", "0:150 1:150", "A:1790300123;C:1586623972;G:1589590632;T:1772883759;N:59214", 150, 150, null, null, 1790300123, 1586623972, 1589590632, 1772883759, 59214, "SRX22205843", "SRS19261251", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96403, 0.96449, 0.05772, 0.05783, 0.74065, 0.74176, 0.47816, 0.48251, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28655, "SRR26502045", "SRX22205833", "SRS19261240", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "T 30 C", "GSM7863835", null, "tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "T 30 C", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863835", "GSM7863835: T 30 C; Danio rerio; RNA Seq", "GSM7863835 r1", "GSM7863835", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "T_30_C_1.fq.gz T_30_C_2.fq.gz", "fastq fastq", 7040817900.0, 23469393.0, "GSM7863835 r1", "0:150 1:150", "A:1876423506;C:1652628465;G:1655836248;T:1855870182;N:59499", 150, 150, null, null, 1876423506, 1652628465, 1655836248, 1855870182, 59499, "SRX22205833", "SRS19261240", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96474, 0.96443, 0.06177, 0.06107, 0.74156, 0.74296, 0.47857, 0.48026, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28656, "SRR26502046", "SRX22205832", "SRS19261241", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "T 30 B", "GSM7863834", null, "tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "T 30 B", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863834", "GSM7863834: T 30 B; Danio rerio; RNA Seq", "GSM7863834 r1", "GSM7863834", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "T_30_B_2.fq.gz T_30_B_1.fq.gz", "fastq fastq", 8200572000.0, 27335240.0, "GSM7863834 r1", "0:150 1:150", "A:2190695852;C:1920433913;G:1925928418;T:2163443322;N:70495", 150, 150, null, null, 2190695852, 1920433913, 1925928418, 2163443322, 70495, "SRX22205832", "SRS19261241", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96433, 0.96457, 0.06642, 0.06644, 0.74533, 0.74649, 0.47782, 0.47682, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28657, "SRR26502047", "SRX22205831", "SRS19261239", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "T 30 A", "GSM7863833", null, "tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "T 30 A", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863833", "GSM7863833: T 30 A; Danio rerio; RNA Seq", "GSM7863833 r1", "GSM7863833", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "T_30_A_1.fq.gz T_30_A_2.fq.gz", "fastq fastq", 7703792100.0, 25679307.0, "GSM7863833 r1", "0:150 1:150", "A:2054907550;C:1804050094;G:1815870062;T:2028898349;N:66045", 150, 150, null, null, 2054907550, 1804050094, 1815870062, 2028898349, 66045, "SRX22205831", "SRS19261239", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96469, 0.96416, 0.05964, 0.05911, 0.74268, 0.74371, 0.48235, 0.4788, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28661, "SRR26502051", "SRX22205827", "SRS19261235", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "N SR C", "GSM7863829", null, "tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "N SR C", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:Nodal ligand ndr2 N|developmental stage:sphere SR|approx time hpf index:1", "GSM7863829", "GSM7863829: N SR C; Danio rerio; RNA Seq", "GSM7863829 r1", "GSM7863829", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "N_SR_C_1.fq.gz N_SR_C_2.fq.gz", "fastq fastq", 7293839400.0, 24312798.0, "GSM7863829 r1", "0:150 1:150", "A:1937032921;C:1719710085;G:1721088212;T:1915877927;N:130255", 150, 150, null, null, 1937032921, 1719710085, 1721088212, 1915877927, 130255, "SRX22205827", "SRS19261235", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96051, 0.95854, 0.05225, 0.05246, 0.74302, 0.74369, 0.48477, 0.48545, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28662, "SRR26502052", "SRX22205826", "SRS19261234", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "N SR B", "GSM7863828", null, "tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "N SR B", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:Nodal ligand ndr2 N|developmental stage:sphere SR|approx time hpf index:1", "GSM7863828", "GSM7863828: N SR B; Danio rerio; RNA Seq", "GSM7863828 r1", "GSM7863828", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "N_SR_B_1.fq.gz N_SR_B_2.fq.gz", "fastq fastq", 6981129600.0, 23270432.0, "GSM7863828 r1", "0:150 1:150", "A:1833880168;C:1660117743;G:1671198288;T:1815844785;N:88616", 150, 150, null, null, 1833880168, 1660117743, 1671198288, 1815844785, 88616, "SRX22205826", "SRS19261234", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.96268, 0.96342, 0.03832, 0.03798, 0.75099, 0.75122, 0.48079, 0.47886, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28663, "SRR26502053", "SRX22205825", "SRS19261232", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "N SR A", "GSM7863827", null, "tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:sphere SR|stage index:1|geo loc name:missing|collection date:missing", "N SR A", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:Nodal ligand ndr2 N|developmental stage:sphere SR|approx time hpf index:1", "GSM7863827", "GSM7863827: N SR A; Danio rerio; RNA Seq", "GSM7863827 r1", "GSM7863827", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "N_SR_A_1.fq.gz N_SR_A_2.fq.gz", "fastq fastq", 6540197400.0, 21800658.0, "GSM7863827 r1", "0:150 1:150", "A:1723386530;C:1550749809;G:1558186202;T:1707756999;N:117860", 150, 150, null, null, 1723386530, 1550749809, 1558186202, 1707756999, 117860, "SRX22205825", "SRS19261232", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.95817, 0.95637, 0.05006, 0.04989, 0.74669, 0.74706, 0.48334, 0.48529, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28676, "SRR26502066", "SRX22205812", "SRS19261220", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "N 30 C", "GSM7863814", null, "tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "N 30 C", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:Nodal ligand ndr2 N|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863814", "GSM7863814: N 30 C; Danio rerio; RNA Seq", "GSM7863814 r1", "GSM7863814", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "N_30_C_1.fq.gz N_30_C_2.fq.gz", "fastq fastq", 6953187900.0, 23177293.0, "GSM7863814 r1", "0:150 1:150", "A:1854651920;C:1630241974;G:1637240320;T:1830930962;N:122724", 150, 150, null, null, 1854651920, 1630241974, 1637240320, 1830930962, 122724, "SRX22205812", "SRS19261220", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.95825, 0.95555, 0.07237, 0.07124, 0.73839, 0.73965, 0.47633, 0.48251, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28677, "SRR26502067", "SRX22205811", "SRS19261219", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "N 30 B", "GSM7863813", null, "tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "N 30 B", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:Nodal ligand ndr2 N|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863813", "GSM7863813: N 30 B; Danio rerio; RNA Seq", "GSM7863813 r1", "GSM7863813", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "N_30_B_1.fq.gz N_30_B_2.fq.gz", "fastq fastq", 7268989200.0, 24229964.0, "GSM7863813 r1", "0:150 1:150", "A:1936589259;C:1705294148;G:1713405013;T:1913574474;N:126306", 150, 150, null, null, 1936589259, 1705294148, 1713405013, 1913574474, 126306, "SRX22205811", "SRS19261219", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.95856, 0.95701, 0.06763, 0.06737, 0.7402, 0.74166, 0.47707, 0.47519, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28678, "SRR26502068", "SRX22205810", "SRS19261218", "SRP468205", "PRJNA1031674", "Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants", "GSE246158", "Transcriptome Analysis", "We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N  constitutively active Nodal receptor CA acvr1b* T  and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR  zfs:0000015 30  50% epiboly 50  shield SH  75% epiboly 75  90% epiboly 90  and 2 somite 2S corresponding to 4  4.7  5.3  6  8  9  and 11 hpf  respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N  CA acvr1b*T  and uninjected U explants with 3 biological replicates A C per condition per stage SR   2S.", null, "pubmed:39651654", null, "N 30 A", "GSM7863812", null, "tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:zfs:0000015 30|stage index:2|geo loc name:missing|collection date:missing", "N 30 A", "Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample", "Zebrafish embryo explants", "Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA  respectively", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", "Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection", "condition:Nodal ligand ndr2 N|developmental stage:zfs:0000015 30|approx time hpf index:2", "GSM7863812", "GSM7863812: N 30 A; Danio rerio; RNA Seq", "GSM7863812 r1", "GSM7863812", "1", "Total RNA was isolated using Trizol reagent  then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP468205", null, "loader:fastq load.py", "N_30_A_1.fq.gz N_30_A_2.fq.gz", "fastq fastq", 7994228400.0, 26647428.0, "GSM7863812 r1", "0:150 1:150", "A:2150876411;C:1856723010;G:1859830754;T:2126659217;N:139008", 150, 150, null, null, 2150876411, 1856723010, 1859830754, 2126659217, 139008, "SRX22205810", "SRS19261218", "SRA1738892", "Baylor College of Medicine", "Baylor College of Medicine", 2, 0.94146, 0.95165, 0.07208, 0.07255, 0.73957, 0.73862, 0.48813, 0.48908, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-24", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28926, "SRR26845660", "SRX22541160", "SRS19550743", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 5hour wt 75mM s4u r3", "GSM7903266", null, "tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 5hour wt 75mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 5 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF]", "GSM7903266", "GSM7903266: zebrafish 5hour wt 75mM s4u r3; Danio rerio; RNA Seq", "GSM7903266 r1", "GSM7903266", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s5h_4.fastq.gz", "fastq", 3876675223.0, 38382923.0, "GSM7903266 r1", "0:101", "A:1271025001;C:726585936;G:783833897;T:1093102254;N:2128135", 101, null, null, null, 1271025001, 726585936, 783833897, 1093102254, 2128135, "SRX22541160", "SRS19550743", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.71995, null, 0.15648, null, 0.80602, null, 0.63112, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28927, "SRR26845661", "SRX22541159", "SRS19550745", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 5hour wt 75mM s4u r2", "GSM7903265", null, "tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 5hour wt 75mM s4u r2", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 5 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF]", "GSM7903265", "GSM7903265: zebrafish 5hour wt 75mM s4u r2; Danio rerio; RNA Seq", "GSM7903265 r1", "GSM7903265", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s5h_3.fastq.gz", "fastq", 3838231795.0, 38002295.0, "GSM7903265 r1", "0:101", "A:1278788159;C:716521940;G:779898774;T:1060882131;N:2140791", 101, null, null, null, 1278788159, 716521940, 779898774, 1060882131, 2140791, "SRX22541159", "SRS19550745", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.72109, null, 0.21985, null, 0.80807, null, 0.6147, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28928, "SRR26845662", "SRX22541158", "SRS19550744", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 5hour wt 75mM s4u r1", "GSM7903264", null, "tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 5hour wt 75mM s4u r1", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 5 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF]", "GSM7903264", "GSM7903264: zebrafish 5hour wt 75mM s4u r1; Danio rerio; RNA Seq", "GSM7903264 r1", "GSM7903264", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s5h_1.fastq.gz", "fastq", 3890509395.0, 38519895.0, "GSM7903264 r1", "0:101", "A:1318641089;C:721557782;G:786950925;T:1061229739;N:2129860", 101, null, null, null, 1318641089, 721557782, 786950925, 1061229739, 2129860, "SRX22541158", "SRS19550744", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.68576, null, 0.20717, null, 0.81935, null, 0.62842, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28929, "SRR26845663", "SRX22541157", "SRS19550742", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 4hour wt 75mM s4u r3", "GSM7903263", null, "tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 4hour wt 75mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 4 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF]", "GSM7903263", "GSM7903263: zebrafish 4hour wt 75mM s4u r3; Danio rerio; RNA Seq", "GSM7903263 r1", "GSM7903263", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s4h_3.fastq.gz", "fastq", 3922621133.0, 38837833.0, "GSM7903263 r1", "0:101", "A:1326034870;C:729550784;G:798297898;T:1066568859;N:2168722", 101, null, null, null, 1326034870, 729550784, 798297898, 1066568859, 2168722, "SRX22541157", "SRS19550742", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.68783, null, 0.16779, null, 0.81621, null, 0.62761, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28930, "SRR26845664", "SRX22541156", "SRS19550741", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 4hour wt 75mM s4u r2", "GSM7903262", null, "tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 4hour wt 75mM s4u r2", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 4 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF]", "GSM7903262", "GSM7903262: zebrafish 4hour wt 75mM s4u r2; Danio rerio; RNA Seq", "GSM7903262 r1", "GSM7903262", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s4h_2.fastq.gz", "fastq", 3885845316.0, 38473716.0, "GSM7903262 r1", "0:101", "A:1305297185;C:711282734;G:795936400;T:1071155283;N:2173714", 101, null, null, null, 1305297185, 711282734, 795936400, 1071155283, 2173714, "SRX22541156", "SRS19550741", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.7205, null, 0.20229, null, 0.81556, null, 0.63986, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28931, "SRR26845665", "SRX22541155", "SRS19550740", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 4hour wt 75mM s4u r1", "GSM7903261", null, "tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 4hour wt 75mM s4u r1", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 4 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF]", "GSM7903261", "GSM7903261: zebrafish 4hour wt 75mM s4u r1; Danio rerio; RNA Seq", "GSM7903261 r1", "GSM7903261", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s4h_1.fastq.gz", "fastq", 4087186695.0, 40467195.0, "GSM7903261 r1", "0:101", "A:1367436080;C:761579394;G:848347911;T:1107470497;N:2352813", 101, null, null, null, 1367436080, 761579394, 848347911, 1107470497, 2352813, "SRX22541155", "SRS19550740", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.7191, null, 0.20848, null, 0.81688, null, 0.63923, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28932, "SRR26845666", "SRX22541154", "SRS19550739", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 3hour wt 75mM s4u r3", "GSM7903260", null, "tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 3hour wt 75mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 3 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF]", "GSM7903260", "GSM7903260: zebrafish 3hour wt 75mM s4u r3; Danio rerio; RNA Seq", "GSM7903260 r1", "GSM7903260", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s3h_3.fastq.gz", "fastq", 4736832532.0, 46899332.0, "GSM7903260 r1", "0:101", "A:1624181445;C:861735952;G:963083636;T:1285203347;N:2628152", 101, null, null, null, 1624181445, 861735952, 963083636, 1285203347, 2628152, "SRX22541154", "SRS19550739", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.71216, null, 0.21983, null, 0.81793, null, 0.63217, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28933, "SRR26845667", "SRX22541153", "SRS19550738", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 3hour wt 75mM s4u r2", "GSM7903259", null, "tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 3hour wt 75mM s4u r2", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 3 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF]", "GSM7903259", "GSM7903259: zebrafish 3hour wt 75mM s4u r2; Danio rerio; RNA Seq", "GSM7903259 r1", "GSM7903259", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s3h_2.fastq.gz", "fastq", 5318262969.0, 52656069.0, "GSM7903259 r1", "0:101", "A:1802889178;C:966732133;G:1084801674;T:1460906618;N:2933366", 101, null, null, null, 1802889178, 966732133, 1084801674, 1460906618, 2933366, "SRX22541153", "SRS19550738", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.70675, null, 0.15939, null, 0.81126, null, 0.61384, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28934, "SRR26845668", "SRX22541152", "SRS19550736", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 3hour wt 75mM s4u r1", "GSM7903258", null, "tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 3hour wt 75mM s4u r1", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 3 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF]", "GSM7903258", "GSM7903258: zebrafish 3hour wt 75mM s4u r1; Danio rerio; RNA Seq", "GSM7903258 r1", "GSM7903258", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s3h_1.fastq.gz", "fastq", 4206425679.0, 41647779.0, "GSM7903258 r1", "0:101", "A:1441873469;C:764690995;G:869706025;T:1127812036;N:2343154", 101, null, null, null, 1441873469, 764690995, 869706025, 1127812036, 2343154, "SRX22541152", "SRS19550736", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.67591, null, 0.16274, null, 0.82175, null, 0.62057, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30050, "SRR27730713", "SRX23396345", "SRS20257259", "SRP485064", "PRJNA1067370", "zebrafish embryo for scRNA seq and bulk RNA seq", "PRJNA1067370", "Other", "Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.", null, null, null, "hamp /  4 hpf embryo", "zebrafish embryo hamp /  4hpf replicate 3", null, "strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:4 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio: 4hpf embryo", "W 24", "W 24", "bulk RNA seq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP485064", null, null, "hamp4h-3_2.fq.gz hamp4h-3_1.fq.gz", "fastq fastq", 6261088500.0, 20870295.0, "hamp4h 3 1.fq.gz", "0:150 1:150", "A:1668720393;C:1449635670;G:1495531397;T:1647100279;N:100761", 150, 150, null, null, 1668720393, 1449635670, 1495531397, 1647100279, 100761, "SRX23396345", "SRS20257259", "SRA1791861", "Shanghai Ocean University|College of Fisheries and Life", "Shanghai Ocean University", 2, 0.94424, 0.94159, 0.04146, 0.0415, 0.75089, 0.75201, 0.48393, 0.48457, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "China", "2024-01-25", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30061, "SRR27730724", "SRX23396334", "SRS20257248", "SRP485064", "PRJNA1067370", "zebrafish embryo for scRNA seq and bulk RNA seq", "PRJNA1067370", "Other", "Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.", null, null, null, "hamp /  4 hpf embryo", "zebrafish embryo hamp /  4hpf replicate 2", null, "strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:4 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio: 4hpf embryo", "W 23", "W 23", "bulk RNA seq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP485064", null, null, "hamp4h-2_1.fq.gz hamp4h-2_2.fq.gz", "fastq fastq", 6140359800.0, 20467866.0, "hamp4h 2 1.fq.gz", "0:150 1:150", "A:1622433757;C:1437175847;G:1481587196;T:1599071088;N:91912", 150, 150, null, null, 1622433757, 1437175847, 1481587196, 1599071088, 91912, "SRX23396334", "SRS20257248", "SRA1791861", "Shanghai Ocean University|College of Fisheries and Life", "Shanghai Ocean University", 2, 0.94763, 0.94713, 0.03975, 0.03948, 0.75045, 0.75193, 0.48915, 0.48855, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "China", "2024-01-25", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30062, "SRR27730725", "SRX23396333", "SRS20257247", "SRP485064", "PRJNA1067370", "zebrafish embryo for scRNA seq and bulk RNA seq", "PRJNA1067370", "Other", "Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.", null, null, null, "hamp /  4 hpf embryo", "zebrafish embryo hamp /  4hpf replicate 1", null, "strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:4 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio: 4hpf embryo", "W 22", "W 22", "bulk RNA seq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP485064", null, null, "hamp4h-1_1.fq.gz hamp4h-1_2.fq.gz", "fastq fastq", 6482302500.0, 21607675.0, "hamp4h 1 1.fq.gz", "0:150 1:150", "A:1723398342;C:1504238189;G:1551942847;T:1702630056;N:93066", 150, 150, null, null, 1723398342, 1504238189, 1551942847, 1702630056, 93066, "SRX23396333", "SRS20257247", "SRA1791861", "Shanghai Ocean University|College of Fisheries and Life", "Shanghai Ocean University", 2, 0.94434, 0.94083, 0.04297, 0.04235, 0.75327, 0.75526, 0.48487, 0.4837, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "China", "2024-01-25", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30063, "SRR27674233", "SRX23341580", "SRS20203706", "SRP485064", "PRJNA1067370", "zebrafish embryo for scRNA seq and bulk RNA seq", "PRJNA1067370", "Other", "Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.", null, null, null, "wild type 4 phf embryo", "zebrafish embryo 4 phf replicate 3", null, "strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:4 phf|dev stage:4 phf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio: 4hpf embryo", "W 3", "W 3", "bulk RNA seq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP485064", null, null, "WT4h-3_1.fq.gz WT4h-3_2.fq.gz", "fastq fastq", 5799593100.0, 19331977.0, "WT4h 3 1.fq.gz", "0:150 1:150", "A:1543677690;C:1345529657;G:1387996505;T:1522341224;N:48024", 150, 150, null, null, 1543677690, 1345529657, 1387996505, 1522341224, 48024, "SRX23341580", "SRS20203706", "SRA1789158", "Shanghai Ocean University|College of Fisheries and Life", "Shanghai Ocean University", 2, 0.94823, 0.94693, 0.0386, 0.03884, 0.74686, 0.74769, 0.47863, 0.48203, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "China", "2024-01-22", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30064, "SRR27674234", "SRX23341579", "SRS20203705", "SRP485064", "PRJNA1067370", "zebrafish embryo for scRNA seq and bulk RNA seq", "PRJNA1067370", "Other", "Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.", null, null, null, "wild type 4 phf embryo", "zebrafish embryo 4 phf replicate 2", null, "strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:4 phf|dev stage:4 phf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio: 4hpf embryo", "W 2", "W 2", "bulk RNA seq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP485064", null, null, "WT4h-2_1.fq.gz WT4h-2_2.fq.gz", "fastq fastq", 6408374700.0, 21361249.0, "WT4h 2 1.fq.gz", "0:150 1:150", "A:1700326501;C:1489928909;G:1544130015;T:1673936668;N:52607", 150, 150, null, null, 1700326501, 1489928909, 1544130015, 1673936668, 52607, "SRX23341579", "SRS20203705", "SRA1789158", "Shanghai Ocean University|College of Fisheries and Life", "Shanghai Ocean University", 2, 0.94833, 0.94724, 0.03589, 0.03528, 0.74521, 0.74665, 0.47991, 0.47552, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "China", "2024-01-22", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30065, "SRR27674235", "SRX23341578", "SRS20203704", "SRP485064", "PRJNA1067370", "zebrafish embryo for scRNA seq and bulk RNA seq", "PRJNA1067370", "Other", "Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.", null, null, null, "wild type 4 phf embryo", "zebrafish embryo 4 phf replicate 1", null, "strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:4 phf|dev stage:4 phf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Danio rerio: 4hpf embryo", "W 1", "W 1", "bulk RNA seq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP485064", null, null, "WT4h-1_1.fq.gz WT4h-1_2.fq.gz", "fastq fastq", 6176335500.0, 20587785.0, "WT4h 1 1.fq.gz", "0:150 1:150", "A:1639564255;C:1436792246;G:1481775020;T:1618153065;N:50914", 150, 150, null, null, 1639564255, 1436792246, 1481775020, 1618153065, 50914, "SRX23341578", "SRS20203704", "SRA1789158", "Shanghai Ocean University|College of Fisheries and Life", "Shanghai Ocean University", 2, 0.94837, 0.94497, 0.03675, 0.03629, 0.74393, 0.74497, 0.48332, 0.48392, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "China", "2024-01-22", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30599, "SRR27865238", "SRX23527802", "SRS20377517", "SRP488009", "PRJNA1073183", "Transcriptome of SEMA5A  MT ATP6  ZNF662  and KDM4C in zebrafish embryos", "PRJNA1073183", "Other", null, null, null, null, "Embryos transcriptome", "Embryos transcriptome", null, "strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "con MO", "6", "6", "con MO", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP488009", null, null, "con-KDM_1.fq.gz con-KDM_2.fq.gz", "fastq fastq", 7088132100.0, 23627107.0, "con KDM 1.fq.gz", "0:150 1:150", "A:1893419600;C:1649526065;G:1662549202;T:1882459200;N:178033", 150, 150, null, null, 1893419600, 1649526065, 1662549202, 1882459200, 178033, "SRX23527802", "SRS20377517", "SRA1797184", "Sichuan University|West China Second University Hospital", "Sichuan University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-02-04", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30600, "SRR27865239", "SRX23527801", "SRS20377517", "SRP488009", "PRJNA1073183", "Transcriptome of SEMA5A  MT ATP6  ZNF662  and KDM4C in zebrafish embryos", "PRJNA1073183", "Other", null, null, null, null, "Embryos transcriptome", "Embryos transcriptome", null, "strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "KDM4C MO", "5", "5", "KDM4C MO", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP488009", null, null, "KDM-MO_1.fq.gz KDM-MO_2.fq.gz", "fastq fastq", 7876840500.0, 26256135.0, "KDM MO 1.fq.gz", "0:150 1:150", "A:2104173142;C:1831662159;G:1843980192;T:2096831538;N:193469", 150, 150, null, null, 2104173142, 1831662159, 1843980192, 2096831538, 193469, "SRX23527801", "SRS20377517", "SRA1797184", "Sichuan University|West China Second University Hospital", "Sichuan University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-02-04", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30601, "SRR27865240", "SRX23527800", "SRS20377517", "SRP488009", "PRJNA1073183", "Transcriptome of SEMA5A  MT ATP6  ZNF662  and KDM4C in zebrafish embryos", "PRJNA1073183", "Other", null, null, null, null, "Embryos transcriptome", "Embryos transcriptome", null, "strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "ZNF662 MO", "4", "4", "ZNF662 MO", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP488009", null, null, "znf547-MO_1.fq.gz znf547-MO_2.fq.gz", "fastq fastq", 7573815300.0, 25246051.0, "znf547 MO 1.fq.gz", "0:150 1:150", "A:2014197761;C:1766587259;G:1782217029;T:2010540623;N:272628", 150, 150, null, null, 2014197761, 1766587259, 1782217029, 2010540623, 272628, "SRX23527800", "SRS20377517", "SRA1797184", "Sichuan University|West China Second University Hospital", "Sichuan University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-02-04", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30602, "SRR27865241", "SRX23527799", "SRS20377517", "SRP488009", "PRJNA1073183", "Transcriptome of SEMA5A  MT ATP6  ZNF662  and KDM4C in zebrafish embryos", "PRJNA1073183", "Other", null, null, null, null, "Embryos transcriptome", "Embryos transcriptome", null, "strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SEMA5A RNA", "3", "3", "SEMA5A RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP488009", null, null, "semRNA_1.fq.gz semRNA_2.fq.gz", "fastq fastq", 5575566000.0, 18585220.0, "semRNA 1.fq.gz", "0:150 1:150", "A:1456001758;C:1325628099;G:1339796989;T:1454076989;N:62165", 150, 150, null, null, 1456001758, 1325628099, 1339796989, 1454076989, 62165, "SRX23527799", "SRS20377517", "SRA1797184", "Sichuan University|West China Second University Hospital", "Sichuan University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-02-04", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30603, "SRR27865242", "SRX23527798", "SRS20377517", "SRP488009", "PRJNA1073183", "Transcriptome of SEMA5A  MT ATP6  ZNF662  and KDM4C in zebrafish embryos", "PRJNA1073183", "Other", null, null, null, null, "Embryos transcriptome", "Embryos transcriptome", null, "strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "MT ATP6 RNA", "2", "2", "MT ATP6 RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP488009", null, null, "ATP6-RNA_1.fq.gz ATP6-RNA_2.fq.gz", "fastq fastq", 5437771200.0, 18125904.0, "ATP6 RNA 1.fq.gz", "0:150 1:150", "A:1438540045;C:1272310670;G:1290121053;T:1436739799;N:59633", 150, 150, null, null, 1438540045, 1272310670, 1290121053, 1436739799, 59633, "SRX23527798", "SRS20377517", "SRA1797184", "Sichuan University|West China Second University Hospital", "Sichuan University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-02-04", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30604, "SRR27865243", "SRX23527797", "SRS20377517", "SRP488009", "PRJNA1073183", "Transcriptome of SEMA5A  MT ATP6  ZNF662  and KDM4C in zebrafish embryos", "PRJNA1073183", "Other", null, null, null, null, "Embryos transcriptome", "Embryos transcriptome", null, "strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "con RNA", "1", "1", "con RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP488009", null, null, "con-RNA_1.fq.gz con-RNA_2.fq.gz", "fastq fastq", 6733158900.0, 22443863.0, "con RNA 1.fq.gz", "0:150 1:150", "A:1766014369;C:1595337569;G:1610127771;T:1761604971;N:74220", 150, 150, null, null, 1766014369, 1595337569, 1610127771, 1761604971, 74220, "SRX23527797", "SRS20377517", "SRA1797184", "Sichuan University|West China Second University Hospital", "Sichuan University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-02-04", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30716, "SRR28342048", "SRX23948605", "SRS20750294", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag RESA CLIP input B3", "3xflag RESA CLIP input B3 AGN003279", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002510|replicate ref:AGN003279|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3737 input|replicate label short:RESA CLIP Upf1 #3737 input B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag RESA HITS CLIP input B3", "AGR004059", "AGR004059", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004059_R1.fastq AGR004059_R2.fastq", "fastq fastq", 15446715026.0, 51148063.0, "AGR004059 R1.fastq.zst", "0:151 1:151", "A:4298384942;C:3080575022;G:4004069877;T:4063619821;N:65364", 151, 151, null, null, 4298384942, 3080575022, 4004069877, 4063619821, 65364, "SRX23948605", "SRS20750294", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30717, "SRR28342039", "SRX23948614", "SRS20750302", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 R843C RESA HITS CLIP B1", "3xflag upf1 R843C RESA HITS CLIP B1 AGN003273", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002507|replicate ref:AGN003273|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3735 IP|replicate label short:RESA CLIP Upf1 #3735 IP B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 R843C RESA HITS CLIP B1", "AGR004053", "AGR004053", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004053_R1.fastq AGR004053_R2.fastq", "fastq fastq", 10545264992.0, 34918096.0, "AGR004053 R1.fastq.zst", "0:151 1:151", "A:2943441620;C:2155828506;G:2709854276;T:2736095568;N:45022", 151, 151, null, null, 2943441620, 2155828506, 2709854276, 2736095568, 45022, "SRX23948614", "SRS20750302", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30718, "SRR28342040", "SRX23948613", "SRS20750303", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 C126S RESA HITS CLIP B2", "3xflag upf1 C126S RESA HITS CLIP B2 AGN003282", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002511|replicate ref:AGN003282|replicate order:2|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3737 IP|replicate label short:RESA CLIP Upf1 #3737 IP B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 C126S RESA HITS CLIP B2", "AGR004062", "AGR004062", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004062_R1.fastq AGR004062_R2.fastq", "fastq fastq", 11134300590.0, 36868545.0, "AGR004062 R1.fastq.zst", "0:151 1:151", "A:3063023630;C:2386509106;G:2925940275;T:2758782993;N:44586", 151, 151, null, null, 3063023630, 2386509106, 2925940275, 2758782993, 44586, "SRX23948613", "SRS20750303", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30719, "SRR28342041", "SRX23948612", "SRS20750301", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 C126S RESA HITS CLIP B1", "3xflag upf1 C126S RESA HITS CLIP B1 AGN003281", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002511|replicate ref:AGN003281|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3737 IP|replicate label short:RESA CLIP Upf1 #3737 IP B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 C126S RESA HITS CLIP B1", "AGR004061", "AGR004061", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004061_R1.fastq AGR004061_R2.fastq", "fastq fastq", 13368435586.0, 44266343.0, "AGR004061 R1.fastq.zst", "0:151 1:151", "A:3603822055;C:2659540495;G:3591989409;T:3513026539;N:57088", 151, 151, null, null, 3603822055, 2659540495, 3591989409, 3513026539, 57088, "SRX23948612", "SRS20750301", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30720, "SRR28342042", "SRX23948611", "SRS20750300", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 G495R/G497E RESA HITS CLIP B2", "3xflag upf1 G495R/G497E RESA HITS CLIP B2 AGN003278", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002509|replicate ref:AGN003278|replicate order:2|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3736 IP|replicate label short:RESA CLIP Upf1 #3736 IP B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 G495R/G497E RESA HITS CLIP B2", "AGR004058", "AGR004058", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004058_R1.fastq AGR004058_R2.fastq", "fastq fastq", 13750586084.0, 45531742.0, "AGR004058 R1.fastq.zst", "0:151 1:151", "A:3775460380;C:2748834924;G:3672092546;T:3554141983;N:56251", 151, 151, null, null, 3775460380, 2748834924, 3672092546, 3554141983, 56251, "SRX23948611", "SRS20750300", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30721, "SRR28342043", "SRX23948610", "SRS20750299", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 G495R/G497E RESA HITS CLIP B1", "3xflag upf1 G495R/G497E RESA HITS CLIP B1 AGN003277", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002509|replicate ref:AGN003277|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3736 IP|replicate label short:RESA CLIP Upf1 #3736 IP B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 G495R/G497E RESA HITS CLIP B1", "AGR004057", "AGR004057", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004057_R1.fastq AGR004057_R2.fastq", "fastq fastq", 10708529212.0, 35458706.0, "AGR004057 R1.fastq.zst", "0:151 1:151", "A:2983511099;C:2231542625;G:2842811089;T:2650619142;N:45257", 151, 151, null, null, 2983511099, 2231542625, 2842811089, 2650619142, 45257, "SRX23948610", "SRS20750299", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30722, "SRR28342044", "SRX23948609", "SRS20750297", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag gfp RESA HITS CLIP B1", "3xflag gfp RESA HITS CLIP B1 AGN002579", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 01 05|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS001970|replicate ref:AGN002579|replicate order:1|project label long:3x flag upf1 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper. Control is 3x flag gfp|project label short:3xflag upf1 RESA HITS CLIP|sample label short:gfp CLIP|replicate label short:gfp CLIP B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag gfp RESA HITS CLIP B1", "AGR003308", "AGR003308", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003308_R1.fastq AGR003308_R2.fastq", "fastq fastq", 507167460.0, 2510730.0, "AGR003308 R1.fastq.zst", "0:101 1:101", "A:156207937;C:97169427;G:111291367;T:142479104;N:19625", 101, 101, null, null, 156207937, 97169427, 111291367, 142479104, 19625, "SRX23948609", "SRS20750297", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30723, "SRR28342045", "SRX23948608", "SRS20750298", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag RESA HITS CLIP input B4", "3xflag RESA CLIP input B4 AGN003267", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002504|replicate ref:AGN003267|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3650 input|replicate label short:RESA CLIP Upf1 #3650 input B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag RESA HITS CLIP input B4", "AGR004047", "AGR004047", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004047_R2.fastq AGR004047_R1.fastq", "fastq fastq", 19396379142.0, 64226421.0, "AGR004047 R1.fastq.zst", "0:151 1:151", "A:5606633601;C:3872715770;G:4910603410;T:5006345083;N:81278", 151, 151, null, null, 5606633601, 3872715770, 4910603410, 5006345083, 81278, "SRX23948608", "SRS20750298", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30724, "SRR28342046", "SRX23948607", "SRS20750295", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf3b RESA HITS CLIP B2", "3xflag upf3b RESA HITS CLIP B2 AGN002796", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002161|replicate ref:AGN002796|replicate order:2|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf3b pulldown|replicate label short:Upf3b pulldown B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf3b RESA HITS CLIP B2", "AGR003554", "AGR003554", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003554_R1.fastq AGR003554_R2.fastq", "fastq fastq", 9047261244.0, 44788422.0, "AGR003554 R1.fastq.zst", "0:101 1:101", "A:2711585737;C:1825740983;G:2076537283;T:2433050799;N:346442", 101, 101, null, null, 2711585737, 1825740983, 2076537283, 2433050799, 346442, "SRX23948607", "SRS20750295", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30725, "SRR28342047", "SRX23948606", "SRS20750296", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf3b RESA HITS CLIP B1", "3xflag upf3b RESA HITS CLIP B1 AGN002795", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002161|replicate ref:AGN002795|replicate order:1|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf3b pulldown|replicate label short:Upf3b pulldown B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf3b RESA HITS CLIP B1", "AGR003549", "AGR003549", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003549_R1.fastq AGR003549_R2.fastq", "fastq fastq", 9617196770.0, 47609885.0, "AGR003549 R1.fastq.zst", "0:101 1:101", "A:2856263963;C:1963091501;G:2218118010;T:2579364306;N:358990", 101, 101, null, null, 2856263963, 1963091501, 2218118010, 2579364306, 358990, "SRX23948606", "SRS20750296", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30726, "SRR28342049", "SRX23948604", "SRS20750292", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf3a RESA HITS CLIP B2", "3xflag upf3a RESA HITS CLIP B2 AGN002792", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002159|replicate ref:AGN002792|replicate order:2|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf3a pulldown|replicate label short:Upf3a pulldown B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf3a RESA HITS CLIP B2", "AGR003566", "AGR003566", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003566_R1.fastq AGR003566_R2.fastq", "fastq fastq", 50318544410.0, 249101705.0, "AGR003566 R1.fastq.zst", "0:101 1:101", "A:14930547705;C:10295739682;G:11624332741;T:13466693890;N:1230392", 101, 101, null, null, 14930547705, 10295739682, 11624332741, 13466693890, 1230392, "SRX23948604", "SRS20750292", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30727, "SRR28342050", "SRX23948603", "SRS20750293", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf3a RESA HITS CLIP B1", "3xflag upf3a RESA HITS CLIP B1 AGN002791", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002159|replicate ref:AGN002791|replicate order:1|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf3a pulldown|replicate label short:Upf3a pulldown B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf3a RESA HITS CLIP B1", "AGR003545", "AGR003545", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003545_R1.fastq AGR003545_R2.fastq", "fastq fastq", 10770959564.0, 53321582.0, "AGR003545 R1.fastq.zst", "0:101 1:101", "A:3207646854;C:2186852059;G:2481889724;T:2894165865;N:405062", 101, 101, null, null, 3207646854, 2186852059, 2481889724, 2894165865, 405062, "SRX23948603", "SRS20750293", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30728, "SRR28342051", "SRX23948602", "SRS20750291", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf2 RESA HITS CLIP B2", "3xflag upf2 RESA HITS CLIP B2 AGN002788", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002157|replicate ref:AGN002788|replicate order:2|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf2 pulldown|replicate label short:Upf2 pulldown B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf2 RESA HITS CLIP B2", "AGR003541", "AGR003541", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003541_R1.fastq AGR003541_R2.fastq", "fastq fastq", 9471117440.0, 46886720.0, "AGR003541 R1.fastq.zst", "0:101 1:101", "A:2852420143;C:1898246719;G:2136843599;T:2583254674;N:352305", 101, 101, null, null, 2852420143, 1898246719, 2136843599, 2583254674, 352305, "SRX23948602", "SRS20750291", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30729, "SRR28342052", "SRX23948601", "SRS20750290", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf2 RESA HITS CLIP B1", "3xflag upf2 RESA HITS CLIP B1 AGN002787", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002157|replicate ref:AGN002787|replicate order:1|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf2 pulldown|replicate label short:Upf2 pulldown B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf2 RESA HITS CLIP B1", "AGR003542", "AGR003542", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003542_R1.fastq AGR003542_R2.fastq", "fastq fastq", 10845546044.0, 53690822.0, "AGR003542 R1.fastq.zst", "0:101 1:101", "A:3277705832;C:2154122837;G:2449408891;T:2963913264;N:395220", 101, 101, null, null, 3277705832, 2154122837, 2449408891, 2963913264, 395220, "SRX23948601", "SRS20750290", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30730, "SRR28342053", "SRX23948600", "SRS20750289", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 RESA HITS CLIP B5", "3xflag upf1 RESA HITS CLIP B5 AGN003270", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002505|replicate ref:AGN003270|replicate order:2|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3650 IP|replicate label short:RESA CLIP Upf1 #3650 IP B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 RESA HITS CLIP B5", "AGR004050", "AGR004050", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004050_R1.fastq AGR004050_R2.fastq", "fastq fastq", 11823214534.0, 39149717.0, "AGR004050 R1.fastq.zst", "0:151 1:151", "A:3184473505;C:2558650081;G:3236214151;T:2843828317;N:48480", 151, 151, null, null, 3184473505, 2558650081, 3236214151, 2843828317, 48480, "SRX23948600", "SRS20750289", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30731, "SRR28342054", "SRX23948599", "SRS20750288", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 RESA HITS CLIP B4", "3xflag upf1 RESA HITS CLIP B4 AGN003269", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002505|replicate ref:AGN003269|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3650 IP|replicate label short:RESA CLIP Upf1 #3650 IP B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 RESA HITS CLIP B4", "AGR004049", "AGR004049", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004049_R1.fastq AGR004049_R2.fastq", "fastq fastq", 14371221754.0, 47586827.0, "AGR004049 R1.fastq.zst", "0:151 1:151", "A:3983698498;C:2912453835;G:3805806498;T:3669203887;N:59036", 151, 151, null, null, 3983698498, 2912453835, 3805806498, 3669203887, 59036, "SRX23948599", "SRS20750288", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30732, "SRR28342055", "SRX23948598", "SRS20750287", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 RESA HITS CLIP B3", "3xflag upf1 RESA HITS CLIP B3 AGN002798", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002154|replicate ref:AGN002798|replicate order:2|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf1 pulldown|replicate label short:Upf1 pulldown B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 RESA HITS CLIP B3", "AGR003555", "AGR003555", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003555_R1.fastq AGR003555_R2.fastq", "fastq fastq", 13605076932.0, 67351866.0, "AGR003555 R1.fastq.zst", "0:101 1:101", "A:3996372048;C:2823464384;G:3156030119;T:3628752419;N:457962", 101, 101, null, null, 3996372048, 2823464384, 3156030119, 3628752419, 457962, "SRX23948598", "SRS20750287", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30733, "SRR28342056", "SRX23948597", "SRS20750283", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 RESA HITS CLIP B2", "3xflag upf1 RESA HITS CLIP B2 AGN002784", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 08 19|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002154|replicate ref:AGN002784|replicate order:1|project label long:3x flag upf1 2 3a 3b RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:3xflag upf1 RESA HITS CLIP|sample label short:Upf1 pulldown|replicate label short:Upf1 pulldown B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 RESA HITS CLIP B2", "AGR003552", "AGR003552", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003552_R1.fastq AGR003552_R2.fastq", "fastq fastq", 10762870878.0, 53281539.0, "AGR003552 R1.fastq.zst", "0:101 1:101", "A:3170047840;C:2223795927;G:2504911576;T:2863700088;N:415447", 101, 101, null, null, 3170047840, 2223795927, 2504911576, 2863700088, 415447, "SRX23948597", "SRS20750283", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30734, "SRR28342057", "SRX23948596", "SRS20750286", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 RESA HITS CLIP B1", "3xflag upf1 RESA HITS CLIP B1 AGN002577", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2021 01 05|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS001968|replicate ref:AGN002577|replicate order:1|project label long:3x flag upf1 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper. Control is 3x flag gfp|project label short:3xflag upf1 RESA HITS CLIP|sample label short:upf1 CLIP|replicate label short:upf1 CLIP B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 RESA HITS CLIP B1", "AGR003306", "AGR003306", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR003306_R1.fastq AGR003306_R2.fastq", "fastq fastq", 529433718.0, 2620959.0, "AGR003306 R1.fastq.zst", "0:101 1:101", "A:157881697;C:106579975;G:122214915;T:142736640;N:20491", 101, 101, null, null, 157881697, 106579975, 122214915, 142736640, 20491, "SRX23948596", "SRS20750286", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30735, "SRR28342058", "SRX23948595", "SRS20750284", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag upf1 R843C RESA HITS CLIP B2", "3xflag upf1 R843C RESA HITS CLIP B2 AGN003274", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002507|replicate ref:AGN003274|replicate order:2|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3735 IP|replicate label short:RESA CLIP Upf1 #3735 IP B2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag upf1 R843C RESA HITS CLIP B2", "AGR004054", "AGR004054", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004054_R1.fastq AGR004054_R2.fastq", "fastq fastq", 12067359790.0, 39958145.0, "AGR004054 R1.fastq.zst", "0:151 1:151", "A:3301899297;C:2532414363;G:3161463027;T:3071532640;N:50463", 151, 151, null, null, 3301899297, 2532414363, 3161463027, 3071532640, 50463, "SRX23948595", "SRS20750284", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30736, "SRR28342059", "SRX23948594", "SRS20750282", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag RESA CLIP input B2", "3xflag RESA CLIP input B2 AGN003275", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002508|replicate ref:AGN003275|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3736 input|replicate label short:RESA CLIP Upf1 #3736 input B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag RESA HITS CLIP input B2", "AGR004055", "AGR004055", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004055_R1.fastq AGR004055_R2.fastq", "fastq fastq", 13295917534.0, 44026217.0, "AGR004055 R1.fastq.zst", "0:151 1:151", "A:3866188367;C:2751508227;G:3344357660;T:3333805406;N:57874", 151, 151, null, null, 3866188367, 2751508227, 3344357660, 3333805406, 57874, "SRX23948594", "SRS20750282", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [30737, "SRR28342060", "SRX23948593", "SRS20750285", "SRP495203", "PRJNA1087701", "UPF1 regulates mRNA stability by sensing poorly translated coding sequences   HITS CLIP.", "PRJNA1087701", "Other", "Post transcriptional mRNA regulation shapes gene expression  yet how cis elements and mRNA translation interface to regulate mRNA stability is poorly understood. We find that strength of translation initiation  uORF content  codon optimality  AU rich elements  microRNA binding sites  and ORF length function combinatorially to regulate mRNA stability. Machine learning analysis identifies ORF length as the most important conserved feature regulating mRNA decay. We find that Upf1 binds poorly translated and untranslated ORFs which are associated with higher decay rate  including mRNAs with uORFs and those with exposed ORFs post stop codons. Our study emphasizes Upf1's converging role in surveilling mRNAs with exposed ORFs that are poorly translated  such as mRNAs with long ORFs  ORF like three primeUTRs  and mRNAs containing uORFs. We propose that Upf1 regulation of poorly/untranslated ORFs provides a unifying mechanism of surveillance in regulating mRNA stability and homeostasis in an EJC independent NMD pathway that we term ORF Mediated Decay OMD.", null, null, null, "3xflag RESA CLIP input B1", "3xflag RESA CLIP input B1 AGN003271", null, "strain:TU/AB|age:3.5 hpf|dev stage:1k cell|collection date:2022 10 04|geo loc name:USA|sex:pooled male and female|tissue:embryo|genotype:wt|strain maternal:wt|strain paternal:wt|molecule:mRNA|selection:flag bead PD post crosslinking|sample ref:AGS002506|replicate ref:AGN003271|replicate order:1|project label long:3x flag upf1 mutants plasmids 3735  3736  3737  3650 RESA HITS CLIP using V.Yartseva's library. Followed protocol in paper|project label short:upf1 mutant RESA HITS CLIP|sample label short:RESA CLIP Upf1 #3735 input|replicate label short:RESA CLIP Upf1 #3735 input B1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "3xflag RESA HITS CLIP input B1", "AGR004051", "AGR004051", "PCR from library specific RT", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "RT-PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495203", null, null, "AGR004051_R1.fastq AGR004051_R2.fastq", "fastq fastq", 14891006336.0, 49307968.0, "AGR004051 R1.fastq.zst", "0:151 1:151", "A:4241333172;C:3027167277;G:3764089225;T:3858355544;N:61118", 151, 151, null, null, 4241333172, 3027167277, 3764089225, 3858355544, 61118, "SRX23948593", "SRS20750285", "SRA1824033", "Yale University|Genetics", "Yale University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2024-03-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32044, "SRR29007855", "SRX24534915", "SRS21280597", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 4h 242215", "GSM8263867", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing", "oligomycin 4h 242215", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf", "GSM8263867", "GSM8263867: oligomycin 4h 242215; Danio rerio; RNA Seq", "GSM8263867 r1", "GSM8263867", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242215_S23_R1_001.fastq.gz", "fastq", 1099252600.0, 10992526.0, "GSM8263867 r1", "0:100", "A:394615526;C:165624413;G:213165848;T:325764464;N:82349", 100, null, null, null, 394615526, 165624413, 213165848, 325764464, 82349, "SRX24534915", "SRS21280597", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32045, "SRR29007856", "SRX24534914", "SRS21280596", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 4h 242212", "GSM8263866", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing", "actinomycinD 4h 242212", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf", "GSM8263866", "GSM8263866: actinomycinD 4h 242212; Danio rerio; RNA Seq", "GSM8263866 r1", "GSM8263866", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242212_S20_R1_001.fastq.gz", "fastq", 1070478700.0, 10704787.0, "GSM8263866 r1", "0:100", "A:386458341;C:166600394;G:207856798;T:309482168;N:80999", 100, null, null, null, 386458341, 166600394, 207856798, 309482168, 80999, "SRX24534914", "SRS21280596", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32046, "SRR29007857", "SRX24534913", "SRS21280595", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 4h 242211", "GSM8263865", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing", "untreated 4h 242211", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf", "GSM8263865", "GSM8263865: untreated 4h 242211; Danio rerio; RNA Seq", "GSM8263865 r1", "GSM8263865", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242211_S19_R1_001.fastq.gz", "fastq", 1093429200.0, 10934292.0, "GSM8263865 r1", "0:100", "A:392334220;C:167896391;G:211513304;T:321602672;N:82613", 100, null, null, null, 392334220, 167896391, 211513304, 321602672, 82613, "SRX24534913", "SRS21280595", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32047, "SRR29007858", "SRX24534912", "SRS21280594", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 3h 242209", "GSM8263864", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing", "oligomycin 3h 242209", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf", "GSM8263864", "GSM8263864: oligomycin 3h 242209; Danio rerio; RNA Seq", "GSM8263864 r1", "GSM8263864", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242209_S17_R1_001.fastq.gz", "fastq", 1033704400.0, 10337044.0, "GSM8263864 r1", "0:100", "A:369215986;C:155452490;G:201728964;T:307228931;N:78029", 100, null, null, null, 369215986, 155452490, 201728964, 307228931, 78029, "SRX24534912", "SRS21280594", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32048, "SRR29007859", "SRX24534911", "SRS21280593", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 3h 242206", "GSM8263863", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing", "actinomycinD 3h 242206", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf", "GSM8263863", "GSM8263863: actinomycinD 3h 242206; Danio rerio; RNA Seq", "GSM8263863 r1", "GSM8263863", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242206_S14_R1_001.fastq.gz", "fastq", 953006400.0, 9530064.0, "GSM8263863 r1", "0:100", "A:347108918;C:144085943;G:185036985;T:276702150;N:72404", 100, null, null, null, 347108918, 144085943, 185036985, 276702150, 72404, "SRX24534911", "SRS21280593", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32049, "SRR29007860", "SRX24534910", "SRS21280592", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 3h 242205", "GSM8263862", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing", "untreated 3h 242205", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf", "GSM8263862", "GSM8263862: untreated 3h 242205; Danio rerio; RNA Seq", "GSM8263862 r1", "GSM8263862", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242205_S13_R1_001.fastq.gz", "fastq", 982492000.0, 9824920.0, "GSM8263862 r1", "0:100", "A:357327274;C:147958580;G:190520366;T:286610800;N:74980", 100, null, null, null, 357327274, 147958580, 190520366, 286610800, 74980, "SRX24534910", "SRS21280592", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32050, "SRR29007861", "SRX24534909", "SRS21280591", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 4h 242203", "GSM8263861", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing", "oligomycin 4h 242203", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf", "GSM8263861", "GSM8263861: oligomycin 4h 242203; Danio rerio; RNA Seq", "GSM8263861 r1", "GSM8263861", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242203_S11_R1_001.fastq.gz", "fastq", 1079609500.0, 10796095.0, "GSM8263861 r1", "0:100", "A:394901944;C:165258089;G:209628914;T:309738395;N:82158", 100, null, null, null, 394901944, 165258089, 209628914, 309738395, 82158, "SRX24534909", "SRS21280591", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32051, "SRR29007862", "SRX24534908", "SRS21280590", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 4h 242200", "GSM8263860", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing", "actinomycinD 4h 242200", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf", "GSM8263860", "GSM8263860: actinomycinD 4h 242200; Danio rerio; RNA Seq", "GSM8263860 r1", "GSM8263860", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242200_S8_R1_001.fastq.gz", "fastq", 1408252700.0, 14082527.0, "GSM8263860 r1", "0:100", "A:522222777;C:222590725;G:272313366;T:391018385;N:107447", 100, null, null, null, 522222777, 222590725, 272313366, 391018385, 107447, "SRX24534908", "SRS21280590", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32052, "SRR29007863", "SRX24534907", "SRS21280589", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 4h 242199", "GSM8263859", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing", "untreated 4h 242199", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf", "GSM8263859", "GSM8263859: untreated 4h 242199; Danio rerio; RNA Seq", "GSM8263859 r1", "GSM8263859", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242199_S7_R1_001.fastq.gz", "fastq", 1125950000.0, 11259500.0, "GSM8263859 r1", "0:100", "A:414249487;C:173739254;G:216615243;T:321259585;N:86431", 100, null, null, null, 414249487, 173739254, 216615243, 321259585, 86431, "SRX24534907", "SRS21280589", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32053, "SRR29007864", "SRX24534906", "SRS21280588", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 3h 242197", "GSM8263858", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing", "oligomycin 3h 242197", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf", "GSM8263858", "GSM8263858: oligomycin 3h 242197; Danio rerio; RNA Seq", "GSM8263858 r1", "GSM8263858", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242197_S5_R1_001.fastq.gz", "fastq", 947773600.0, 9477736.0, "GSM8263858 r1", "0:100", "A:338345008;C:149341339;G:191300275;T:268714670;N:72308", 100, null, null, null, 338345008, 149341339, 191300275, 268714670, 72308, "SRX24534906", "SRS21280588", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32054, "SRR29007865", "SRX24534905", "SRS21280587", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 3h 242194", "GSM8263857", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing", "actinomycinD 3h 242194", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf", "GSM8263857", "GSM8263857: actinomycinD 3h 242194; Danio rerio; RNA Seq", "GSM8263857 r1", "GSM8263857", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242194_S2_R1_001.fastq.gz", "fastq", 886739500.0, 8867395.0, "GSM8263857 r1", "0:100", "A:323640364;C:133799218;G:171921906;T:257310512;N:67500", 100, null, null, null, 323640364, 133799218, 171921906, 257310512, 67500, "SRX24534905", "SRS21280587", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32055, "SRR29007866", "SRX24534904", "SRS21280586", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 3h 242193", "GSM8263856", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing", "untreated 3h 242193", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf", "GSM8263856", "GSM8263856: untreated 3h 242193; Danio rerio; RNA Seq", "GSM8263856 r1", "GSM8263856", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "242193_S1_R1_001.fastq.gz", "fastq", 916695300.0, 9166953.0, "GSM8263856 r1", "0:100", "A:336335924;C:139550128;G:175519815;T:265220434;N:68999", 100, null, null, null, 336335924, 139550128, 175519815, 265220434, 68999, "SRX24534904", "SRS21280586", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32056, "SRR29007867", "SRX24534903", "SRS21280585", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 4h 239880", "GSM8263855", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing", "oligomycin 4h 239880", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf", "GSM8263855", "GSM8263855: oligomycin 4h 239880; Danio rerio; RNA Seq", "GSM8263855 r1", "GSM8263855", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239880_S26_R1_001.fastq.gz", "fastq", 941675800.0, 9416758.0, "GSM8263855 r1", "0:100", "A:336490804;C:149956011;G:188167115;T:266990985;N:70885", 100, null, null, null, 336490804, 149956011, 188167115, 266990985, 70885, "SRX24534903", "SRS21280585", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32057, "SRR29007868", "SRX24534902", "SRS21280584", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 4h 239877", "GSM8263854", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing", "actinomycinD 4h 239877", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf", "GSM8263854", "GSM8263854: actinomycinD 4h 239877; Danio rerio; RNA Seq", "GSM8263854 r1", "GSM8263854", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239877_S29_R1_001.fastq.gz", "fastq", 948649000.0, 9486490.0, "GSM8263854 r1", "0:100", "A:342507039;C:152067872;G:190301212;T:263700389;N:72488", 100, null, null, null, 342507039, 152067872, 190301212, 263700389, 72488, "SRX24534902", "SRS21280584", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32058, "SRR29007869", "SRX24534901", "SRS21280583", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 4h 239876", "GSM8263853", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing", "untreated 4h 239876", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf", "GSM8263853", "GSM8263853: untreated 4h 239876; Danio rerio; RNA Seq", "GSM8263853 r1", "GSM8263853", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239876_S30_R1_001.fastq.gz", "fastq", 1007891300.0, 10078913.0, "GSM8263853 r1", "0:100", "A:364202353;C:163475447;G:200200777;T:279934364;N:78359", 100, null, null, null, 364202353, 163475447, 200200777, 279934364, 78359, "SRX24534901", "SRS21280583", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32059, "SRR29007870", "SRX24534900", "SRS21280582", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 3h 239874", "GSM8263852", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing", "oligomycin 3h 239874", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf", "GSM8263852", "GSM8263852: oligomycin 3h 239874; Danio rerio; RNA Seq", "GSM8263852 r1", "GSM8263852", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239874_S32_R1_001.fastq.gz", "fastq", 921745200.0, 9217452.0, "GSM8263852 r1", "0:100", "A:336277555;C:146537533;G:183166424;T:255692785;N:70903", 100, null, null, null, 336277555, 146537533, 183166424, 255692785, 70903, "SRX24534900", "SRS21280582", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32060, "SRR29007871", "SRX24534899", "SRS21280581", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 3h 239871", "GSM8263851", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing", "actinomycinD 3h 239871", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf", "GSM8263851", "GSM8263851: actinomycinD 3h 239871; Danio rerio; RNA Seq", "GSM8263851 r1", "GSM8263851", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239871_S35_R1_001.fastq.gz", "fastq", 916824700.0, 9168247.0, "GSM8263851 r1", "0:100", "A:339437453;C:141033621;G:179228990;T:257055652;N:68984", 100, null, null, null, 339437453, 141033621, 179228990, 257055652, 68984, "SRX24534899", "SRS21280581", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32061, "SRR29007872", "SRX24534898", "SRS21280580", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 3h 239870", "GSM8263850", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing", "untreated 3h 239870", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf", "GSM8263850", "GSM8263850: untreated 3h 239870; Danio rerio; RNA Seq", "GSM8263850 r1", "GSM8263850", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239870_S36_R1_001.fastq.gz", "fastq", 1093077000.0, 10930770.0, "GSM8263850 r1", "0:100", "A:401209579;C:172475514;G:213719175;T:305590035;N:82697", 100, null, null, null, 401209579, 172475514, 213719175, 305590035, 82697, "SRX24534898", "SRS21280580", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32062, "SRR29007873", "SRX24534897", "SRS21280579", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 4h 239868", "GSM8263849", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing", "oligomycin 4h 239868", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf", "GSM8263849", "GSM8263849: oligomycin 4h 239868; Danio rerio; RNA Seq", "GSM8263849 r1", "GSM8263849", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239868_S38_R1_001.fastq.gz", "fastq", 931115800.0, 9311158.0, "GSM8263849 r1", "0:100", "A:338486092;C:143219862;G:183831900;T:265505765;N:72181", 100, null, null, null, 338486092, 143219862, 183831900, 265505765, 72181, "SRX24534897", "SRS21280579", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32063, "SRR29007874", "SRX24534896", "SRS21280578", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 4h 239865", "GSM8263848", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing", "actinomycinD 4h 239865", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf", "GSM8263848", "GSM8263848: actinomycinD 4h 239865; Danio rerio; RNA Seq", "GSM8263848 r1", "GSM8263848", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239865_S41_R1_001.fastq.gz", "fastq", 980144600.0, 9801446.0, "GSM8263848 r1", "0:100", "A:357739294;C:155149563;G:194671261;T:272508646;N:75836", 100, null, null, null, 357739294, 155149563, 194671261, 272508646, 75836, "SRX24534896", "SRS21280578", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32064, "SRR29007875", "SRX24534895", "SRS21280577", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "untreated 4h 239864", "GSM8263847", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing", "untreated 4h 239864", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf", "GSM8263847", "GSM8263847: untreated 4h 239864; Danio rerio; RNA Seq", "GSM8263847 r1", "GSM8263847", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239864_S42_R1_001.fastq.gz", "fastq", 1087115200.0, 10871152.0, "GSM8263847 r1", "0:100", "A:399350905;C:169940057;G:211828210;T:305913039;N:82989", 100, null, null, null, 399350905, 169940057, 211828210, 305913039, 82989, "SRX24534895", "SRS21280577", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32065, "SRR29007876", "SRX24534894", "SRS21280576", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "oligomycin 3h 239862", "GSM8263846", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing", "oligomycin 3h 239862", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf", "GSM8263846", "GSM8263846: oligomycin 3h 239862; Danio rerio; RNA Seq", "GSM8263846 r1", "GSM8263846", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239862_S44_R1_001.fastq.gz", "fastq", 964699000.0, 9646990.0, "GSM8263846 r1", "0:100", "A:356569674;C:145609333;G:187599003;T:274847064;N:73926", 100, null, null, null, 356569674, 145609333, 187599003, 274847064, 73926, "SRX24534894", "SRS21280576", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [32066, "SRR29007877", "SRX24534893", "SRS21280575", "SRP507323", "PRJNA1111056", "Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis", "GSE267318", "Transcriptome Analysis", "Mitochondrial energy production is essential for development  yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development  we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages  followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity  abundance  morphology  metabolome  proteome and phospho proteome as well as respiratory chain enzymatic activity  we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis  is not limited by metabolic substrates at early stages  and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead  our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall  our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos  we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and  actinomycin injected embryos to block zygotic transcription.", null, null, null, "actinomycinD 3h 239859", "GSM8263845", null, "source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing", "actinomycinD 3h 239859", "Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier  and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome  phiX174 genome  and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c  alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting  s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample", "Embryo", "Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore  495455 1\u00b5M  actinomycin D Sigma Aldrich  A1410 10\u00b5g/ml. Untreated embryos were kept alongside as controls.", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", "E3 medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4  10\u22125% methylene blue.", "tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf", "GSM8263845", "GSM8263845: actinomycinD 3h 239859; Danio rerio; RNA Seq", "GSM8263845 r1", "GSM8263845", "1", "Total RNA was extracted using RNeasy Mini Kit Qiagen  175023525. 1.5\u00b5g of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP507323", null, "loader:fastq load.py", "239859_S47_R1_001.fastq.gz", "fastq", 859559300.0, 8595593.0, "GSM8263845 r1", "0:100", "A:318619535;C:133947193;G:169107548;T:237818588;N:66436", 100, null, null, null, 318619535, 133947193, 169107548, 237818588, 66436, "SRX24534893", "SRS21280575", "SRA1865615", "Pauli, IMP", "Pauli, IMP", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "poly_a", "lexogen", "bulk", "unknown", "unknown", null, "Austria", "2024-05-13", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 1095, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "Blastula", "p1": "Embryo Imprecise"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 717, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "OTHER", "label": "OTHER", "count": 346, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=OTHER", "selected": false}, {"value": "RIP-Seq", "label": "RIP-Seq", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=RIP-Seq", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=miRNA-Seq", "selected": false}, {"value": "AMPLICON", "label": "AMPLICON", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=AMPLICON", "selected": false}, {"value": "FL-cDNA", "label": "FL-cDNA", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=FL-cDNA", "selected": false}, {"value": "Bisulfite-Seq", "label": "Bisulfite-Seq", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=Bisulfite-Seq", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_strategy=ncRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 1089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "cDNA", "label": "cDNA", "count": 518, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=cDNA", "selected": false}, {"value": "unspecified", "label": "unspecified", "count": 373, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=unspecified", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 69, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=Oligo-dT", "selected": false}, {"value": "other", "label": "other", "count": 54, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=other", "selected": false}, {"value": "RT-PCR", "label": "RT-PCR", "count": 38, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=RT-PCR", "selected": false}, {"value": "PCR", "label": "PCR", "count": 18, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=PCR", "selected": false}, {"value": "CAGE", "label": "CAGE", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=CAGE", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=size+fractionation", "selected": false}, {"value": "RANDOM", "label": "RANDOM", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_selection=RANDOM", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 608, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 487, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 1069, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.platform=ILLUMINA", "selected": false}, {"value": "PACBIO_SMRT", "label": "PACBIO_SMRT", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.platform=PACBIO_SMRT", "selected": false}, {"value": "BGISEQ", "label": "BGISEQ", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.platform=BGISEQ", "selected": false}, {"value": "ABI_SOLID", "label": "ABI_SOLID", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.platform=ABI_SOLID", "selected": false}, {"value": "ION_TORRENT", "label": "ION_TORRENT", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.platform=ION_TORRENT", "selected": false}, {"value": "OXFORD_NANOPORE", "label": "OXFORD_NANOPORE", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&experiment.platform=OXFORD_NANOPORE", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo", "label": "Embryo", "count": 1095, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "Blastula", "label": "Blastula", "count": 1095, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Embryo+Imprecise", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 1095, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&tissue_curation_coarse=All+anatomical+structures", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 1095, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise", "results": [{"value": "unknown", "label": "unknown", "count": 696, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=unknown", "selected": false}, {"value": "iclip", "label": "iclip", "count": 276, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=iclip", "selected": false}, {"value": "bulk", "label": "bulk", "count": 78, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=bulk", "selected": false}, {"value": "10x", "label": "10x", "count": 24, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=10x", "selected": false}, {"value": "dropseq", "label": "dropseq", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=dropseq", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=generic-scrnaseq-only", "selected": false}, {"value": "indrops", "label": "indrops", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&technology=indrops", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "32066", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Blastula&tissue_curation=Embryo+Imprecise&_next=32066", "private": false, "allow_execute_sql": true, "query_ms": 131.37330500467215}